Incidental Mutation 'R5570:Crym'
ID435612
Institutional Source Beutler Lab
Gene Symbol Crym
Ensembl Gene ENSMUSG00000030905
Gene Namecrystallin, mu
Synonyms
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5570 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location120186380-120202111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120201893 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 11 (E11G)
Ref Sequence ENSEMBL: ENSMUSP00000033198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033198] [ENSMUST00000084640]
PDB Structure
Crystal structure of the apo form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Crystal structure of the NADPH form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Cristal structure of the NADPH-T3 form of mouse Mu-crystallin. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000033198
AA Change: E11G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000033198
Gene: ENSMUSG00000030905
AA Change: E11G

DomainStartEndE-ValueType
Pfam:OCD_Mu_crystall 3 313 7.1e-113 PFAM
Pfam:Shikimate_DH 124 227 7.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084640
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143257
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific and ubiquitous. The former class is also called phylogenetically-restricted crystallins. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. This gene encodes a taxon-specific crystallin protein that binds NADPH and has sequence similarity to bacterial ornithine cyclodeaminases. The encoded protein does not perform a structural role in lens tissue, and instead it binds thyroid hormone for possible regulatory or developmental roles. Mutations in this gene have been associated with autosomal dominant non-syndromic deafness. [provided by RefSeq, Sep 2014]
PHENOTYPE: At the euthyroid state, homozygotes display a normal growth curve, heart rate and hearing ability but have significantly reduced serum concentrations of triiodothyronine (T3) and thyroxine (T4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Crym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01562:Crym APN 7 120195399 missense probably damaging 0.98
IGL03355:Crym APN 7 120199313 splice site probably null
R0393:Crym UTSW 7 120189749 missense probably benign 0.00
R1538:Crym UTSW 7 120197715 missense probably benign 0.05
R2508:Crym UTSW 7 120201827 missense probably benign 0.08
R3836:Crym UTSW 7 120201216 missense probably benign 0.03
R4328:Crym UTSW 7 120195339 missense probably damaging 1.00
R4723:Crym UTSW 7 120201075 critical splice donor site probably null
R5046:Crym UTSW 7 120195444 missense possibly damaging 0.71
R5122:Crym UTSW 7 120195495 missense probably benign 0.00
R5266:Crym UTSW 7 120199294 missense probably benign 0.00
R5427:Crym UTSW 7 120199222 unclassified probably benign
R5567:Crym UTSW 7 120201893 missense probably benign 0.00
R5704:Crym UTSW 7 120201940 unclassified probably null
R6835:Crym UTSW 7 120186645 missense probably benign
R7274:Crym UTSW 7 120190519 missense probably benign 0.03
R7536:Crym UTSW 7 120201108 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCCCCTTAAGTAGCAGC -3'
(R):5'- CCCTGGAATCCAAGGAGTTG -3'

Sequencing Primer
(F):5'- GCCCCTTAAGTAGCAGCTGTTATTAG -3'
(R):5'- CAAGGAGTTGGGGTGGGC -3'
Posted On2016-10-24