Incidental Mutation 'R5570:Map3k9'
ID435628
Institutional Source Beutler Lab
Gene Symbol Map3k9
Ensembl Gene ENSMUSG00000042724
Gene Namemitogen-activated protein kinase kinase kinase 9
SynonymsMlk1
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5570 (G1)
Quality Score211
Status Not validated
Chromosome12
Chromosomal Location81721010-81781175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 81732024 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 505 (L505P)
Ref Sequence ENSEMBL: ENSMUSP00000041819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035987] [ENSMUST00000222322]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035987
AA Change: L505P

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000041819
Gene: ENSMUSG00000042724
AA Change: L505P

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
SH3 48 108 1.61e-20 SMART
TyrKc 137 396 6.72e-89 SMART
low complexity region 449 469 N/A INTRINSIC
low complexity region 573 590 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 736 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
low complexity region 901 915 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000222322
AA Change: L505P

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223292
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Olfr49 A G 14: 54,282,368 F176L probably damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Map3k9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Map3k9 APN 12 81729698 missense probably benign 0.00
IGL01098:Map3k9 APN 12 81724154 missense probably damaging 1.00
IGL01122:Map3k9 APN 12 81732126 missense possibly damaging 0.94
IGL01680:Map3k9 APN 12 81724739 missense probably benign 0.10
IGL01997:Map3k9 APN 12 81772697 missense probably damaging 1.00
IGL02178:Map3k9 APN 12 81743837 missense probably damaging 1.00
IGL02724:Map3k9 APN 12 81724742 missense probably benign
PIT4366001:Map3k9 UTSW 12 81772761 missense possibly damaging 0.95
R0530:Map3k9 UTSW 12 81722482 missense probably benign 0.00
R0541:Map3k9 UTSW 12 81734223 missense possibly damaging 0.79
R0550:Map3k9 UTSW 12 81725781 missense probably damaging 1.00
R0799:Map3k9 UTSW 12 81722269 missense probably benign 0.27
R1730:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1783:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1859:Map3k9 UTSW 12 81724482 missense possibly damaging 0.82
R1917:Map3k9 UTSW 12 81780790 nonsense probably null
R3121:Map3k9 UTSW 12 81743924 missense probably damaging 1.00
R3779:Map3k9 UTSW 12 81743791 splice site probably benign
R3931:Map3k9 UTSW 12 81772917 missense probably damaging 0.99
R3951:Map3k9 UTSW 12 81722521 missense probably benign
R4571:Map3k9 UTSW 12 81734091 missense probably benign 0.25
R4728:Map3k9 UTSW 12 81722373 missense probably damaging 0.96
R4857:Map3k9 UTSW 12 81724627 missense probably benign 0.42
R4882:Map3k9 UTSW 12 81724162 missense probably damaging 1.00
R5077:Map3k9 UTSW 12 81734077 splice site probably null
R5369:Map3k9 UTSW 12 81722052 missense probably damaging 0.98
R5418:Map3k9 UTSW 12 81743817 nonsense probably null
R5540:Map3k9 UTSW 12 81772813 missense probably damaging 1.00
R5567:Map3k9 UTSW 12 81732024 missense possibly damaging 0.67
R5696:Map3k9 UTSW 12 81734122 missense probably benign 0.00
R6539:Map3k9 UTSW 12 81732192 missense probably damaging 0.98
R6542:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6816:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6964:Map3k9 UTSW 12 81773003 missense probably benign 0.00
R7027:Map3k9 UTSW 12 81730624 missense probably benign 0.06
R7055:Map3k9 UTSW 12 81724208 missense probably damaging 0.99
R7082:Map3k9 UTSW 12 81724702 missense probably damaging 1.00
R7247:Map3k9 UTSW 12 81725830 missense possibly damaging 0.65
R7424:Map3k9 UTSW 12 81724097 missense probably benign 0.00
R7476:Map3k9 UTSW 12 81743808 missense probably damaging 1.00
R7638:Map3k9 UTSW 12 81724732 missense probably benign 0.00
R8098:Map3k9 UTSW 12 81734114 missense probably damaging 0.99
R8249:Map3k9 UTSW 12 81780777 missense unknown
R8356:Map3k9 UTSW 12 81734118 missense probably damaging 0.98
R8397:Map3k9 UTSW 12 81722362 missense probably benign 0.13
R8444:Map3k9 UTSW 12 81722196 missense probably damaging 1.00
R8456:Map3k9 UTSW 12 81734118 missense probably damaging 0.98
X0025:Map3k9 UTSW 12 81724412 missense possibly damaging 0.58
Z1176:Map3k9 UTSW 12 81772782 missense possibly damaging 0.76
Z1177:Map3k9 UTSW 12 81722279 missense probably damaging 0.99
Z1177:Map3k9 UTSW 12 81780846 missense unknown
Predicted Primers PCR Primer
(F):5'- AATGGACGTTCCCCGAAAG -3'
(R):5'- CTTTCTGCACTGAGACCCAC -3'

Sequencing Primer
(F):5'- TGGCAGCCACTGAGCAAG -3'
(R):5'- TGTCTGTAGGAGCTCCGAAC -3'
Posted On2016-10-24