Mutagenetix > Incidental Mutations

Incidental Mutation 'R5570:Cadps'

435632

Institutional Source

Beutler Lab

Gene Symbol

Cadps

Ensembl Gene

ENSMUSG00000054423

Gene Name

Ca2+-dependent secretion activator

Synonyms

CAPS1

MMRRC Submission

043127-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5570 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

12372563-12823079 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 12473497 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 876 (I876N)

Ref Sequence

ENSEMBL: ENSMUSP00000136076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067491] [ENSMUST00000112657] [ENSMUST00000112658] [ENSMUST00000177814] [ENSMUST00000224882]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067491
AA Change: I888N

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000064706
Gene: ENSMUSG00000054423
AA Change: I888N

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	772	783	N/A	INTRINSIC
DUF1041	833	948	6.21e-54	SMART
low complexity region	1022	1045	N/A	INTRINSIC
low complexity region	1354	1361	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112657
AA Change: I874N

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000108276
Gene: ENSMUSG00000054423
AA Change: I874N

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	775	786	N/A	INTRINSIC
DUF1041	836	941	3.88e-55	SMART
low complexity region	1015	1038	N/A	INTRINSIC
low complexity region	1347	1354	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112658
AA Change: I875N

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000108277
Gene: ENSMUSG00000054423
AA Change: I875N

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	776	787	N/A	INTRINSIC
DUF1041	837	942	3.88e-55	SMART
low complexity region	1016	1039	N/A	INTRINSIC
low complexity region	1348	1355	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177814
AA Change: I876N

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000136076
Gene: ENSMUSG00000054423
AA Change: I876N

Domain	Start	End	E-Value	Type
low complexity region	5	18	N/A	INTRINSIC
low complexity region	41	75	N/A	INTRINSIC
coiled coil region	93	121	N/A	INTRINSIC
C2	397	492	1.08e-2	SMART
PH	520	624	1.78e-10	SMART
low complexity region	777	788	N/A	INTRINSIC
DUF1041	838	943	2.75e-55	SMART
low complexity region	1017	1040	N/A	INTRINSIC
low complexity region	1349	1356	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224106

Predicted Effect

unknown
Transcript: ENSMUST00000224581
AA Change: I61N

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224704

Predicted Effect

probably benign
Transcript: ENSMUST00000224882

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel neural/endocrine-specific cytosolic and peripheral membrane protein required for the Ca2+-regulated exocytosis of secretory vesicles. The protein acts at a stage in exocytosis that follows ATP-dependent priming, which involves the essential synthesis of phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2). Alternative splicing has been observed at this locus and three variants, encoding distinct isoforms, are described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous null mice display neonatal lethality, respiratory failure and abnormal adrenal gland physiology. Adult heterozygous null mice display abnormal adrenal gland physiology that is different from that seen in homozygous neonates. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acrv1	C	A	9: 36,694,281	S41R	probably damaging	Het
Aqr	G	A	2: 114,148,970	T328M	probably damaging	Het
Arhgap26	C	A	18: 39,099,618	D99E	probably damaging	Het
Boc	G	A	16: 44,492,824	T559I	probably damaging	Het
Cep72	T	C	13: 74,040,141	Q211R	probably benign	Het
Clmp	T	C	9: 40,772,530		probably null	Het
Coq6	T	A	12: 84,368,639	D145E	probably benign	Het
Crym	T	C	7: 120,201,893	E11G	probably benign	Het
Defb36	T	A	2: 152,612,583	V54E	probably damaging	Het
Dlg5	C	A	14: 24,192,913	E55*	probably null	Het
Dock2	G	T	11: 34,727,406	R128S	probably damaging	Het
E330034G19Rik	A	G	14: 24,296,824	K60E	possibly damaging	Het
Eps8l2	G	A	7: 141,355,007	R76Q	possibly damaging	Het
Espn	T	C	4: 152,123,780	E460G	probably damaging	Het
Fbxl18	A	G	5: 142,895,267		probably benign	Het
Fgd5	T	C	6: 91,988,687	S476P	probably damaging	Het
Gsto1	T	C	19: 47,857,899	W62R	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gxylt1	A	G	15: 93,254,299		probably null	Het
Hs6st1	C	T	1: 36,103,638	P218L	probably benign	Het
Kif5c	A	G	2: 49,730,199	D226G	possibly damaging	Het
Krt1	A	G	15: 101,846,905	F473S	probably benign	Het
Lpxn	T	A	19: 12,832,659	M265K	possibly damaging	Het
Map3k9	A	G	12: 81,732,024	L505P	possibly damaging	Het
Mcm3ap	C	T	10: 76,481,096	R645W	possibly damaging	Het
Msr1	T	C	8: 39,611,719	I305V	probably benign	Het
Muc4	A	G	16: 32,777,692	E3237G	possibly damaging	Het
Necap1	T	C	6: 122,881,512	F105L	probably damaging	Het
Nploc4	C	T	11: 120,384,614	V499M	probably benign	Het
Nup93	T	C	8: 94,314,670	V812A	probably damaging	Het
Olfr1012	G	A	2: 85,759,650	S242F	probably damaging	Het
Olfr1328	T	A	4: 118,934,066	I259F	possibly damaging	Het
Olfr49	A	G	14: 54,282,368	F176L	probably damaging	Het
Parn	G	A	16: 13,665,930	P50L	probably damaging	Het
Pcdhb7	T	C	18: 37,344,171	C787R	probably benign	Het
Pdk2	A	T	11: 95,030,000	I175N	probably damaging	Het
Pelo	T	C	13: 115,089,616	I102V	probably benign	Het
Phf12	A	G	11: 78,018,111	D339G	possibly damaging	Het
Phlpp1	A	T	1: 106,173,432	I477F	probably benign	Het
Pigt	T	A	2: 164,501,562	Y319*	probably null	Het
Pmpca	A	G	2: 26,390,541	E133G	probably damaging	Het
Ptgs2	A	G	1: 150,104,108	I321M	probably damaging	Het
Pus7l	G	A	15: 94,527,865	P552S	probably benign	Het
Qsox2	A	G	2: 26,225,218	M1T	probably null	Het
Rara	C	G	11: 98,972,652	R382G	probably damaging	Het
Rbbp6	A	G	7: 123,001,834		probably benign	Het
Rev3l	T	C	10: 39,852,075		probably null	Het
Robo3	T	A	9: 37,425,275	Y399F	possibly damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Skint3	A	G	4: 112,235,798	M20V	probably benign	Het
Slc17a6	A	G	7: 51,658,756	D276G	probably benign	Het
Sult3a2	A	T	10: 33,778,272	V128D	probably damaging	Het
Syt3	T	A	7: 44,390,619	V92E	possibly damaging	Het
Them7	A	G	2: 105,378,808	T158A	probably benign	Het
Utp14b	G	A	1: 78,665,401	D339N	probably damaging	Het
Vars	T	C	17: 35,016,238	F1259L	probably benign	Het
Vmn1r115	A	C	7: 20,844,630	V119G	possibly damaging	Het
Zc3h12a	C	T	4: 125,120,373	R293H	probably damaging	Het
Zfp638	A	T	6: 83,979,188	E1592D	probably damaging	Het

Other mutations in Cadps

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00926:Cadps	APN	14	12491795	missense	probably damaging	1.00
IGL00990:Cadps	APN	14	12715374	missense	possibly damaging	0.56
IGL01071:Cadps	APN	14	12509091	splice site	probably null
IGL01339:Cadps	APN	14	12486543	missense	possibly damaging	0.58
IGL01518:Cadps	APN	14	12522352	missense	probably damaging	1.00
IGL01560:Cadps	APN	14	12491792	missense	probably damaging	1.00
IGL01598:Cadps	APN	14	12522202	critical splice donor site	probably null
IGL01603:Cadps	APN	14	12454154	splice site	probably benign
IGL01836:Cadps	APN	14	12522311	missense	probably damaging	1.00
IGL01839:Cadps	APN	14	12467184	splice site	probably benign
IGL01932:Cadps	APN	14	12373609	utr 3 prime	probably benign
IGL02172:Cadps	APN	14	12705681	missense	probably damaging	1.00
IGL02175:Cadps	APN	14	12467092	missense	probably damaging	0.96
IGL02212:Cadps	APN	14	12522345	missense	possibly damaging	0.94
IGL02351:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02358:Cadps	APN	14	12597380	missense	probably damaging	0.99
IGL02499:Cadps	APN	14	12822725	nonsense	probably null
IGL02505:Cadps	APN	14	12449759	missense	probably damaging	1.00
IGL02591:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02592:Cadps	APN	14	12473465	missense	probably damaging	1.00
IGL02671:Cadps	APN	14	12491824	missense	probably damaging	1.00
IGL02956:Cadps	APN	14	12418047	splice site	probably benign
IGL03029:Cadps	APN	14	12376675	missense	probably damaging	1.00
IGL03216:Cadps	APN	14	12439944	missense	probably damaging	1.00
IGL03282:Cadps	APN	14	12465856	splice site	probably benign
turbo	UTSW	14	12491800	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0241:Cadps	UTSW	14	12376675	missense	probably damaging	1.00
R0420:Cadps	UTSW	14	12491800	missense	probably damaging	1.00
R1180:Cadps	UTSW	14	12457836	splice site	probably benign
R1398:Cadps	UTSW	14	12449822	missense	probably damaging	1.00
R1678:Cadps	UTSW	14	12517802	critical splice donor site	probably null
R1792:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12449802	missense	possibly damaging	0.93
R1863:Cadps	UTSW	14	12505796	missense	probably benign	0.09
R1918:Cadps	UTSW	14	12546372	missense	probably damaging	0.99
R1920:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1921:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1922:Cadps	UTSW	14	12465859	missense	possibly damaging	0.64
R1925:Cadps	UTSW	14	12705726	missense	probably damaging	1.00
R1966:Cadps	UTSW	14	12822450	nonsense	probably null
R2013:Cadps	UTSW	14	12522337	missense	probably damaging	1.00
R2228:Cadps	UTSW	14	12465935	missense	probably benign	0.05
R2331:Cadps	UTSW	14	12603692	missense	probably damaging	1.00
R3436:Cadps	UTSW	14	12616158	splice site	probably null
R3853:Cadps	UTSW	14	12509090	splice site	probably benign
R3893:Cadps	UTSW	14	12488883	utr 3 prime	probably benign
R3916:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3917:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R3953:Cadps	UTSW	14	12505937	missense	probably damaging	1.00
R3966:Cadps	UTSW	14	12522161	splice site	probably null
R4024:Cadps	UTSW	14	12705539	missense	probably damaging	1.00
R4079:Cadps	UTSW	14	12457702	missense	probably benign	0.00
R4230:Cadps	UTSW	14	12488987	missense	probably damaging	0.98
R4333:Cadps	UTSW	14	12467031	missense	probably damaging	1.00
R4410:Cadps	UTSW	14	12822323	missense	probably damaging	0.98
R4586:Cadps	UTSW	14	12505808	missense	probably damaging	1.00
R4685:Cadps	UTSW	14	12467139	missense	possibly damaging	0.77
R4698:Cadps	UTSW	14	12705654	missense	possibly damaging	0.90
R4855:Cadps	UTSW	14	12822449	missense	unknown
R4898:Cadps	UTSW	14	12411588	missense	possibly damaging	0.86
R4908:Cadps	UTSW	14	12536386	missense	probably damaging	1.00
R5208:Cadps	UTSW	14	12457711	missense	possibly damaging	0.68
R5297:Cadps	UTSW	14	12822345	missense	probably damaging	1.00
R5328:Cadps	UTSW	14	12457790	missense	probably benign	0.31
R5408:Cadps	UTSW	14	12705759	missense	possibly damaging	0.87
R5529:Cadps	UTSW	14	12454285	missense	probably damaging	1.00
R5567:Cadps	UTSW	14	12473497	missense	possibly damaging	0.49
R5727:Cadps	UTSW	14	12486525	nonsense	probably null
R5812:Cadps	UTSW	14	12376685	missense	probably benign
R6361:Cadps	UTSW	14	12491778	nonsense	probably null
R6767:Cadps	UTSW	14	12550888	missense	probably damaging	1.00
R6805:Cadps	UTSW	14	12467103	missense	probably damaging	0.99
R6861:Cadps	UTSW	14	12522401	nonsense	probably null
R6883:Cadps	UTSW	14	12465883	missense	probably damaging	0.96
R6887:Cadps	UTSW	14	12505811	missense	probably damaging	1.00
R6997:Cadps	UTSW	14	12505793	missense	possibly damaging	0.88
R7102:Cadps	UTSW	14	12603738	missense	probably damaging	1.00
R7120:Cadps	UTSW	14	12439919	missense	probably damaging	0.98
R7143:Cadps	UTSW	14	12491838	missense	probably benign	0.02
R7290:Cadps	UTSW	14	12616099	missense	probably damaging	1.00
X0018:Cadps	UTSW	14	12373690	missense	probably damaging	1.00
X0028:Cadps	UTSW	14	12467118	missense	possibly damaging	0.93
Z1088:Cadps	UTSW	14	12467113	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AACTCAAGTTAAGGCATCTTGC -3'
(R):5'- GCTGGAGCACTGTTCTCGTAAG -3'

Sequencing Primer
(F):5'- AGTTAAGGCATCTTGCTCACAGC -3'
(R):5'- TGACAATGACAAGGTGGCTTTATG -3'

Posted On

2016-10-24