Mutagenetix > Incidental Mutations

Incidental Mutation 'R5570:Olfr49'

435635

Institutional Source

Beutler Lab

Gene Symbol

Olfr49

Ensembl Gene

ENSMUSG00000048153

Gene Name

olfactory receptor 49

Synonyms

MOR118-1, IC6, GA_x6K02T2QVSB-39745261-39746202

MMRRC Submission

043127-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R5570 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

54278253-54284939 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 54282368 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 176 (F176L)

Ref Sequence

ENSEMBL: ENSMUSP00000149840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059996] [ENSMUST00000216214]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059996
AA Change: F176L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000054361
Gene: ENSMUSG00000048153
AA Change: F176L

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	4.4e-51	PFAM
Pfam:7tm_1	39	289	3.5e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000216214
AA Change: F176L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acrv1	C	A	9: 36,694,281	S41R	probably damaging	Het
Aqr	G	A	2: 114,148,970	T328M	probably damaging	Het
Arhgap26	C	A	18: 39,099,618	D99E	probably damaging	Het
Boc	G	A	16: 44,492,824	T559I	probably damaging	Het
Cadps	A	T	14: 12,473,497	I876N	possibly damaging	Het
Cep72	T	C	13: 74,040,141	Q211R	probably benign	Het
Clmp	T	C	9: 40,772,530		probably null	Het
Coq6	T	A	12: 84,368,639	D145E	probably benign	Het
Crym	T	C	7: 120,201,893	E11G	probably benign	Het
Defb36	T	A	2: 152,612,583	V54E	probably damaging	Het
Dlg5	C	A	14: 24,192,913	E55*	probably null	Het
Dock2	G	T	11: 34,727,406	R128S	probably damaging	Het
E330034G19Rik	A	G	14: 24,296,824	K60E	possibly damaging	Het
Eps8l2	G	A	7: 141,355,007	R76Q	possibly damaging	Het
Espn	T	C	4: 152,123,780	E460G	probably damaging	Het
Fbxl18	A	G	5: 142,895,267		probably benign	Het
Fgd5	T	C	6: 91,988,687	S476P	probably damaging	Het
Gsto1	T	C	19: 47,857,899	W62R	probably damaging	Het
Gtf2h3	C	T	5: 124,584,297	T121I	probably benign	Het
Gxylt1	A	G	15: 93,254,299		probably null	Het
Hs6st1	C	T	1: 36,103,638	P218L	probably benign	Het
Kif5c	A	G	2: 49,730,199	D226G	possibly damaging	Het
Krt1	A	G	15: 101,846,905	F473S	probably benign	Het
Lpxn	T	A	19: 12,832,659	M265K	possibly damaging	Het
Map3k9	A	G	12: 81,732,024	L505P	possibly damaging	Het
Mcm3ap	C	T	10: 76,481,096	R645W	possibly damaging	Het
Msr1	T	C	8: 39,611,719	I305V	probably benign	Het
Muc4	A	G	16: 32,777,692	E3237G	possibly damaging	Het
Necap1	T	C	6: 122,881,512	F105L	probably damaging	Het
Nploc4	C	T	11: 120,384,614	V499M	probably benign	Het
Nup93	T	C	8: 94,314,670	V812A	probably damaging	Het
Olfr1012	G	A	2: 85,759,650	S242F	probably damaging	Het
Olfr1328	T	A	4: 118,934,066	I259F	possibly damaging	Het
Parn	G	A	16: 13,665,930	P50L	probably damaging	Het
Pcdhb7	T	C	18: 37,344,171	C787R	probably benign	Het
Pdk2	A	T	11: 95,030,000	I175N	probably damaging	Het
Pelo	T	C	13: 115,089,616	I102V	probably benign	Het
Phf12	A	G	11: 78,018,111	D339G	possibly damaging	Het
Phlpp1	A	T	1: 106,173,432	I477F	probably benign	Het
Pigt	T	A	2: 164,501,562	Y319*	probably null	Het
Pmpca	A	G	2: 26,390,541	E133G	probably damaging	Het
Ptgs2	A	G	1: 150,104,108	I321M	probably damaging	Het
Pus7l	G	A	15: 94,527,865	P552S	probably benign	Het
Qsox2	A	G	2: 26,225,218	M1T	probably null	Het
Rara	C	G	11: 98,972,652	R382G	probably damaging	Het
Rbbp6	A	G	7: 123,001,834		probably benign	Het
Rev3l	T	C	10: 39,852,075		probably null	Het
Robo3	T	A	9: 37,425,275	Y399F	possibly damaging	Het
Rpl31	C	T	1: 39,370,027	R41C	probably benign	Het
Skint3	A	G	4: 112,235,798	M20V	probably benign	Het
Slc17a6	A	G	7: 51,658,756	D276G	probably benign	Het
Sult3a2	A	T	10: 33,778,272	V128D	probably damaging	Het
Syt3	T	A	7: 44,390,619	V92E	possibly damaging	Het
Them7	A	G	2: 105,378,808	T158A	probably benign	Het
Utp14b	G	A	1: 78,665,401	D339N	probably damaging	Het
Vars	T	C	17: 35,016,238	F1259L	probably benign	Het
Vmn1r115	A	C	7: 20,844,630	V119G	possibly damaging	Het
Zc3h12a	C	T	4: 125,120,373	R293H	probably damaging	Het
Zfp638	A	T	6: 83,979,188	E1592D	probably damaging	Het

Other mutations in Olfr49

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Olfr49	APN	14	54282724	missense	probably damaging	1.00
IGL02197:Olfr49	APN	14	54281952	makesense	probably null
PIT4581001:Olfr49	UTSW	14	54282538	missense	probably damaging	1.00
R4095:Olfr49	UTSW	14	54282731	missense	probably benign	0.38
R4673:Olfr49	UTSW	14	54282332	missense	possibly damaging	0.71
R4795:Olfr49	UTSW	14	54282547	missense	probably damaging	1.00
R4867:Olfr49	UTSW	14	54282629	missense	probably benign	0.21
R5206:Olfr49	UTSW	14	54282698	missense	probably benign
R5567:Olfr49	UTSW	14	54282368	missense	probably damaging	1.00
R5806:Olfr49	UTSW	14	54282807	missense	probably benign
R5848:Olfr49	UTSW	14	54282565	missense	possibly damaging	0.90
R7012:Olfr49	UTSW	14	54282217	missense	possibly damaging	0.84
R7680:Olfr49	UTSW	14	54282380	missense	probably damaging	0.98
R7787:Olfr49	UTSW	14	54282712	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGCCATAGAAGAGAGACACC -3'
(R):5'- CAGGTATGTGGCCATTTGTAACC -3'

Sequencing Primer
(F):5'- GAGCAAGTTGAGAAGGCTTTC -3'
(R):5'- ATGTGGCCATTTGTAACCCTTTG -3'

Posted On

2016-10-24