Incidental Mutation 'R5570:Olfr49'
ID435635
Institutional Source Beutler Lab
Gene Symbol Olfr49
Ensembl Gene ENSMUSG00000048153
Gene Nameolfactory receptor 49
SynonymsMOR118-1, IC6, GA_x6K02T2QVSB-39745261-39746202
MMRRC Submission 043127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R5570 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location54278253-54284939 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54282368 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 176 (F176L)
Ref Sequence ENSEMBL: ENSMUSP00000149840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059996] [ENSMUST00000216214]
Predicted Effect probably damaging
Transcript: ENSMUST00000059996
AA Change: F176L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054361
Gene: ENSMUSG00000048153
AA Change: F176L

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 4.4e-51 PFAM
Pfam:7tm_1 39 289 3.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216214
AA Change: F176L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acrv1 C A 9: 36,694,281 S41R probably damaging Het
Aqr G A 2: 114,148,970 T328M probably damaging Het
Arhgap26 C A 18: 39,099,618 D99E probably damaging Het
Boc G A 16: 44,492,824 T559I probably damaging Het
Cadps A T 14: 12,473,497 I876N possibly damaging Het
Cep72 T C 13: 74,040,141 Q211R probably benign Het
Clmp T C 9: 40,772,530 probably null Het
Coq6 T A 12: 84,368,639 D145E probably benign Het
Crym T C 7: 120,201,893 E11G probably benign Het
Defb36 T A 2: 152,612,583 V54E probably damaging Het
Dlg5 C A 14: 24,192,913 E55* probably null Het
Dock2 G T 11: 34,727,406 R128S probably damaging Het
E330034G19Rik A G 14: 24,296,824 K60E possibly damaging Het
Eps8l2 G A 7: 141,355,007 R76Q possibly damaging Het
Espn T C 4: 152,123,780 E460G probably damaging Het
Fbxl18 A G 5: 142,895,267 probably benign Het
Fgd5 T C 6: 91,988,687 S476P probably damaging Het
Gsto1 T C 19: 47,857,899 W62R probably damaging Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gxylt1 A G 15: 93,254,299 probably null Het
Hs6st1 C T 1: 36,103,638 P218L probably benign Het
Kif5c A G 2: 49,730,199 D226G possibly damaging Het
Krt1 A G 15: 101,846,905 F473S probably benign Het
Lpxn T A 19: 12,832,659 M265K possibly damaging Het
Map3k9 A G 12: 81,732,024 L505P possibly damaging Het
Mcm3ap C T 10: 76,481,096 R645W possibly damaging Het
Msr1 T C 8: 39,611,719 I305V probably benign Het
Muc4 A G 16: 32,777,692 E3237G possibly damaging Het
Necap1 T C 6: 122,881,512 F105L probably damaging Het
Nploc4 C T 11: 120,384,614 V499M probably benign Het
Nup93 T C 8: 94,314,670 V812A probably damaging Het
Olfr1012 G A 2: 85,759,650 S242F probably damaging Het
Olfr1328 T A 4: 118,934,066 I259F possibly damaging Het
Parn G A 16: 13,665,930 P50L probably damaging Het
Pcdhb7 T C 18: 37,344,171 C787R probably benign Het
Pdk2 A T 11: 95,030,000 I175N probably damaging Het
Pelo T C 13: 115,089,616 I102V probably benign Het
Phf12 A G 11: 78,018,111 D339G possibly damaging Het
Phlpp1 A T 1: 106,173,432 I477F probably benign Het
Pigt T A 2: 164,501,562 Y319* probably null Het
Pmpca A G 2: 26,390,541 E133G probably damaging Het
Ptgs2 A G 1: 150,104,108 I321M probably damaging Het
Pus7l G A 15: 94,527,865 P552S probably benign Het
Qsox2 A G 2: 26,225,218 M1T probably null Het
Rara C G 11: 98,972,652 R382G probably damaging Het
Rbbp6 A G 7: 123,001,834 probably benign Het
Rev3l T C 10: 39,852,075 probably null Het
Robo3 T A 9: 37,425,275 Y399F possibly damaging Het
Rpl31 C T 1: 39,370,027 R41C probably benign Het
Skint3 A G 4: 112,235,798 M20V probably benign Het
Slc17a6 A G 7: 51,658,756 D276G probably benign Het
Sult3a2 A T 10: 33,778,272 V128D probably damaging Het
Syt3 T A 7: 44,390,619 V92E possibly damaging Het
Them7 A G 2: 105,378,808 T158A probably benign Het
Utp14b G A 1: 78,665,401 D339N probably damaging Het
Vars T C 17: 35,016,238 F1259L probably benign Het
Vmn1r115 A C 7: 20,844,630 V119G possibly damaging Het
Zc3h12a C T 4: 125,120,373 R293H probably damaging Het
Zfp638 A T 6: 83,979,188 E1592D probably damaging Het
Other mutations in Olfr49
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Olfr49 APN 14 54282724 missense probably damaging 1.00
IGL02197:Olfr49 APN 14 54281952 makesense probably null
PIT4581001:Olfr49 UTSW 14 54282538 missense probably damaging 1.00
R4095:Olfr49 UTSW 14 54282731 missense probably benign 0.38
R4673:Olfr49 UTSW 14 54282332 missense possibly damaging 0.71
R4795:Olfr49 UTSW 14 54282547 missense probably damaging 1.00
R4867:Olfr49 UTSW 14 54282629 missense probably benign 0.21
R5206:Olfr49 UTSW 14 54282698 missense probably benign
R5567:Olfr49 UTSW 14 54282368 missense probably damaging 1.00
R5806:Olfr49 UTSW 14 54282807 missense probably benign
R5848:Olfr49 UTSW 14 54282565 missense possibly damaging 0.90
R7012:Olfr49 UTSW 14 54282217 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GCTGCCATAGAAGAGAGACACC -3'
(R):5'- CAGGTATGTGGCCATTTGTAACC -3'

Sequencing Primer
(F):5'- GAGCAAGTTGAGAAGGCTTTC -3'
(R):5'- ATGTGGCCATTTGTAACCCTTTG -3'
Posted On2016-10-24