Incidental Mutation 'R5571:Itpripl2'
ID435670
Institutional Source Beutler Lab
Gene Symbol Itpripl2
Ensembl Gene ENSMUSG00000095115
Gene Nameinositol 1,4,5-triphosphate receptor interacting protein-like 2
Synonyms
MMRRC Submission 044395-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5571 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118485111-118491975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118489869 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 489 (R489Q)
Ref Sequence ENSEMBL: ENSMUSP00000136409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178344]
Predicted Effect probably damaging
Transcript: ENSMUST00000178344
AA Change: R489Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136409
Gene: ENSMUSG00000095115
AA Change: R489Q

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
transmembrane domain 46 64 N/A INTRINSIC
Mab-21 161 501 1.58e-72 SMART
Meta Mutation Damage Score 0.1157 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,249,123 C232S probably damaging Het
9530053A07Rik A G 7: 28,156,569 D1927G probably damaging Het
Atad5 T C 11: 80,111,556 V1058A probably benign Het
Baiap2l2 T C 15: 79,271,583 H97R probably damaging Het
Bax A G 7: 45,461,891 S184P probably damaging Het
Bsph1 T G 7: 13,450,915 M1R probably null Het
Cbln2 A G 18: 86,713,148 D27G probably benign Het
Cntnap3 G A 13: 64,903,758 A28V probably damaging Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Dhrs3 T G 4: 144,893,564 I17S probably benign Het
Ep300 T C 15: 81,643,217 probably benign Het
Epb41 T C 4: 131,937,406 probably benign Het
Fat4 A T 3: 39,010,274 E4793V probably damaging Het
Fbxw22 T G 9: 109,403,088 K80N probably damaging Het
Fbxw24 T C 9: 109,606,998 E322G probably benign Het
Fndc7 T C 3: 108,856,408 I639V possibly damaging Het
Folh1 T C 7: 86,734,120 Y473C probably damaging Het
Foxb2 T A 19: 16,872,767 M292L probably benign Het
Gapvd1 A G 2: 34,715,253 S41P probably damaging Het
Gm8298 A T 3: 59,877,219 H371L probably damaging Het
Gmds A T 13: 31,917,721 probably null Het
Gp6 G T 7: 4,368,900 A302D probably damaging Het
Hmgcr A T 13: 96,666,663 M8K probably benign Het
Kmo T C 1: 175,647,194 V175A possibly damaging Het
Lce1i C T 3: 92,777,681 G63S unknown Het
Lrp1b T C 2: 41,408,342 Q155R probably damaging Het
Mdm1 T C 10: 118,159,683 S541P possibly damaging Het
Mgea5 T C 19: 45,777,006 T121A probably benign Het
Neto2 C T 8: 85,640,544 D524N probably damaging Het
Olfr1350 T C 7: 6,570,825 I278T possibly damaging Het
Olfr183 A T 16: 59,000,206 I174L probably benign Het
Olfr319 T A 11: 58,702,051 F117I probably damaging Het
Olfr338 A G 2: 36,377,117 T114A probably benign Het
Ppp4r1 C T 17: 65,803,861 Q21* probably null Het
Ryr2 T A 13: 11,555,448 T4930S possibly damaging Het
Siae G A 9: 37,616,923 G64D probably benign Het
Slc14a2 T C 18: 78,209,067 M10V possibly damaging Het
Ssrp1 C G 2: 85,044,325 D496E probably damaging Het
Steap2 A G 5: 5,675,912 S371P probably damaging Het
Taf6l G A 19: 8,783,930 R24W probably damaging Het
Tbkbp1 T C 11: 97,148,729 Q118R probably damaging Het
Tln2 C T 9: 67,334,320 G1001E possibly damaging Het
Tm2d3 A G 7: 65,699,124 N184D probably damaging Het
Tmprss2 A T 16: 97,590,871 W131R probably null Het
Ube2d2a A G 18: 35,770,478 probably benign Het
Unc13d A G 11: 116,063,654 Y1043H probably benign Het
Usp34 T A 11: 23,457,975 I2600K probably damaging Het
Vmn1r198 A G 13: 22,354,998 Y218C probably damaging Het
Vmn2r8 T C 5: 108,802,240 Y247C probably damaging Het
Wdr59 A T 8: 111,465,831 N699K probably damaging Het
Zcchc2 T C 1: 106,023,672 V579A probably benign Het
Zfhx3 A T 8: 108,955,991 Q3354L unknown Het
Other mutations in Itpripl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02397:Itpripl2 APN 7 118490296 missense probably damaging 1.00
R0633:Itpripl2 UTSW 7 118490256 missense probably benign 0.01
R2154:Itpripl2 UTSW 7 118489884 missense probably damaging 0.99
R2186:Itpripl2 UTSW 7 118491277 missense probably damaging 0.99
R2237:Itpripl2 UTSW 7 118490071 missense probably benign
R4830:Itpripl2 UTSW 7 118491057 missense probably benign
R5583:Itpripl2 UTSW 7 118489878 missense probably benign 0.01
R5753:Itpripl2 UTSW 7 118491009 missense probably damaging 0.96
R5833:Itpripl2 UTSW 7 118489971 missense probably benign 0.32
R6913:Itpripl2 UTSW 7 118491109 missense possibly damaging 0.49
R7079:Itpripl2 UTSW 7 118490869 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCATGGGAAAGGGGCATTTG -3'
(R):5'- TGGAGGTGCTTCTGAACGAG -3'

Sequencing Primer
(F):5'- CATTTGGTCAGGTGGAGTGTAATCAG -3'
(R):5'- TGCTTCTGAACGAGGGCAG -3'
Posted On2016-10-24