Incidental Mutation 'R5571:5830411N06Rik'
ID 435671
Institutional Source Beutler Lab
Gene Symbol 5830411N06Rik
Ensembl Gene ENSMUSG00000054672
Gene Name RIKEN cDNA 5830411N06 gene
Synonyms Scart2
MMRRC Submission 044395-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5571 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 140247284-140300736 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140249123 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 232 (C232S)
Ref Sequence ENSEMBL: ENSMUSP00000091520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093984] [ENSMUST00000164583]
AlphaFold B3F5L4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000059882
SMART Domains Protein: ENSMUSP00000061346
Gene: ENSMUSG00000054672

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000093984
AA Change: C232S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091520
Gene: ENSMUSG00000054672
AA Change: C232S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
SR 238 336 1.65e-34 SMART
SR 340 440 4.53e-32 SMART
SR 446 546 8.78e-30 SMART
SR 551 651 1.26e-53 SMART
SR 656 756 2.88e-16 SMART
SR 783 883 7.62e-48 SMART
transmembrane domain 903 925 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164583
AA Change: C232S

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000131905
Gene: ENSMUSG00000054672
AA Change: C232S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SR 29 130 1.49e-18 SMART
SR 137 233 2.53e-4 SMART
Blast:SR 291 349 5e-12 BLAST
SR 354 452 1.65e-34 SMART
SR 456 556 4.53e-32 SMART
SR 562 662 8.78e-30 SMART
SR 667 767 1.26e-53 SMART
SR 772 872 2.88e-16 SMART
SR 899 999 7.62e-48 SMART
transmembrane domain 1019 1041 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210212
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik A G 7: 28,156,569 D1927G probably damaging Het
Atad5 T C 11: 80,111,556 V1058A probably benign Het
Baiap2l2 T C 15: 79,271,583 H97R probably damaging Het
Bax A G 7: 45,461,891 S184P probably damaging Het
Bsph1 T G 7: 13,450,915 M1R probably null Het
Cbln2 A G 18: 86,713,148 D27G probably benign Het
Cntnap3 G A 13: 64,903,758 A28V probably damaging Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Dhrs3 T G 4: 144,893,564 I17S probably benign Het
Ep300 T C 15: 81,643,217 probably benign Het
Epb41 T C 4: 131,937,406 probably benign Het
Fat4 A T 3: 39,010,274 E4793V probably damaging Het
Fbxw22 T G 9: 109,403,088 K80N probably damaging Het
Fbxw24 T C 9: 109,606,998 E322G probably benign Het
Fndc7 T C 3: 108,856,408 I639V possibly damaging Het
Folh1 T C 7: 86,734,120 Y473C probably damaging Het
Foxb2 T A 19: 16,872,767 M292L probably benign Het
Gapvd1 A G 2: 34,715,253 S41P probably damaging Het
Gm8298 A T 3: 59,877,219 H371L probably damaging Het
Gmds A T 13: 31,917,721 probably null Het
Gp6 G T 7: 4,368,900 A302D probably damaging Het
Hmgcr A T 13: 96,666,663 M8K probably benign Het
Itpripl2 C T 7: 118,489,869 R489Q probably damaging Het
Kmo T C 1: 175,647,194 V175A possibly damaging Het
Lce1i C T 3: 92,777,681 G63S unknown Het
Lrp1b T C 2: 41,408,342 Q155R probably damaging Het
Mdm1 T C 10: 118,159,683 S541P possibly damaging Het
Mgea5 T C 19: 45,777,006 T121A probably benign Het
Neto2 C T 8: 85,640,544 D524N probably damaging Het
Olfr1350 T C 7: 6,570,825 I278T possibly damaging Het
Olfr183 A T 16: 59,000,206 I174L probably benign Het
Olfr319 T A 11: 58,702,051 F117I probably damaging Het
Olfr338 A G 2: 36,377,117 T114A probably benign Het
Ppp4r1 C T 17: 65,803,861 Q21* probably null Het
Ryr2 T A 13: 11,555,448 T4930S possibly damaging Het
Siae G A 9: 37,616,923 G64D probably benign Het
Slc14a2 T C 18: 78,209,067 M10V possibly damaging Het
Ssrp1 C G 2: 85,044,325 D496E probably damaging Het
Steap2 A G 5: 5,675,912 S371P probably damaging Het
Taf6l G A 19: 8,783,930 R24W probably damaging Het
Tbkbp1 T C 11: 97,148,729 Q118R probably damaging Het
Tln2 C T 9: 67,334,320 G1001E possibly damaging Het
Tm2d3 A G 7: 65,699,124 N184D probably damaging Het
Tmprss2 A T 16: 97,590,871 W131R probably null Het
Ube2d2a A G 18: 35,770,478 probably benign Het
Unc13d A G 11: 116,063,654 Y1043H probably benign Het
Usp34 T A 11: 23,457,975 I2600K probably damaging Het
Vmn1r198 A G 13: 22,354,998 Y218C probably damaging Het
Vmn2r8 T C 5: 108,802,240 Y247C probably damaging Het
Wdr59 A T 8: 111,465,831 N699K probably damaging Het
Zcchc2 T C 1: 106,023,672 V579A probably benign Het
Zfhx3 A T 8: 108,955,991 Q3354L unknown Het
Other mutations in 5830411N06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:5830411N06Rik APN 7 140294842 missense probably damaging 0.99
IGL01101:5830411N06Rik APN 7 140296104 missense probably benign 0.35
IGL01120:5830411N06Rik APN 7 140296559 missense probably benign 0.02
IGL01958:5830411N06Rik APN 7 140274127 missense probably damaging 1.00
IGL02150:5830411N06Rik APN 7 140297859 missense possibly damaging 0.84
IGL02193:5830411N06Rik APN 7 140249000 missense probably benign 0.17
IGL02239:5830411N06Rik APN 7 140295843 missense probably damaging 1.00
IGL02335:5830411N06Rik APN 7 140296540 missense probably damaging 1.00
IGL02569:5830411N06Rik APN 7 140298362 missense probably benign 0.01
IGL02993:5830411N06Rik APN 7 140296573 missense probably benign 0.07
IGL03261:5830411N06Rik APN 7 140294833 missense probably benign 0.00
IGL03365:5830411N06Rik APN 7 140296769 missense probably damaging 1.00
IGL03399:5830411N06Rik APN 7 140247956 missense probably benign 0.00
IGL03052:5830411N06Rik UTSW 7 140248914 missense probably damaging 1.00
PIT4791001:5830411N06Rik UTSW 7 140274062 missense possibly damaging 0.53
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0021:5830411N06Rik UTSW 7 140296397 missense probably benign 0.15
R0347:5830411N06Rik UTSW 7 140297854 missense probably damaging 1.00
R0374:5830411N06Rik UTSW 7 140248961 missense probably damaging 1.00
R0639:5830411N06Rik UTSW 7 140247959 missense probably benign 0.01
R0667:5830411N06Rik UTSW 7 140261537 missense possibly damaging 0.73
R0789:5830411N06Rik UTSW 7 140248220 missense probably damaging 1.00
R0959:5830411N06Rik UTSW 7 140294791 missense probably damaging 1.00
R1316:5830411N06Rik UTSW 7 140299670 missense probably benign 0.09
R1764:5830411N06Rik UTSW 7 140297265 missense probably benign 0.00
R2247:5830411N06Rik UTSW 7 140249129 missense probably null 0.96
R2379:5830411N06Rik UTSW 7 140299769 missense probably benign 0.15
R4112:5830411N06Rik UTSW 7 140298368 nonsense probably null
R4114:5830411N06Rik UTSW 7 140297910 missense probably damaging 1.00
R4346:5830411N06Rik UTSW 7 140247965 missense probably damaging 0.97
R4836:5830411N06Rik UTSW 7 140299108 missense probably benign
R4956:5830411N06Rik UTSW 7 140298362 missense probably benign 0.00
R5208:5830411N06Rik UTSW 7 140298036 missense probably benign 0.00
R5583:5830411N06Rik UTSW 7 140296826 missense probably damaging 1.00
R5645:5830411N06Rik UTSW 7 140248940 missense possibly damaging 0.95
R6183:5830411N06Rik UTSW 7 140296034 missense possibly damaging 0.82
R6995:5830411N06Rik UTSW 7 140261601 missense probably benign
R7436:5830411N06Rik UTSW 7 140261607 missense probably benign
R7621:5830411N06Rik UTSW 7 140296829 missense probably damaging 1.00
R7662:5830411N06Rik UTSW 7 140294812 missense possibly damaging 0.58
R7669:5830411N06Rik UTSW 7 140296321 missense possibly damaging 0.47
R7686:5830411N06Rik UTSW 7 140249052 missense probably benign 0.00
R7985:5830411N06Rik UTSW 7 140296893 missense probably damaging 1.00
R8330:5830411N06Rik UTSW 7 140296318 nonsense probably null
R8843:5830411N06Rik UTSW 7 140249000 missense possibly damaging 0.93
R8888:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R8895:5830411N06Rik UTSW 7 140261619 missense possibly damaging 0.93
R9044:5830411N06Rik UTSW 7 140248097 missense probably damaging 1.00
R9142:5830411N06Rik UTSW 7 140297893 missense probably damaging 1.00
R9152:5830411N06Rik UTSW 7 140297343 missense possibly damaging 0.55
R9470:5830411N06Rik UTSW 7 140247432 missense probably benign 0.07
R9509:5830411N06Rik UTSW 7 140299731 nonsense probably null
R9522:5830411N06Rik UTSW 7 140274074 missense possibly damaging 0.73
R9755:5830411N06Rik UTSW 7 140261631 critical splice donor site probably null
R9794:5830411N06Rik UTSW 7 140294803 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGAATGTGGCACTGCTC -3'
(R):5'- GGCTTCTTAGGAATCACAGCC -3'

Sequencing Primer
(F):5'- ACTGCTCTGCAATGGTCCAG -3'
(R):5'- GAGCACAACTTTCAGGGGTTTCC -3'
Posted On 2016-10-24