Incidental Mutation 'R5571:Neto2'
ID 435672
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Name neuropilin (NRP) and tolloid (TLL)-like 2
Synonyms 5530601C23Rik
MMRRC Submission 044395-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R5571 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 86363217-86427553 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 86367173 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 524 (D524N)
Ref Sequence ENSEMBL: ENSMUSP00000150062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
AlphaFold Q8BNJ6
Predicted Effect probably damaging
Transcript: ENSMUST00000109686
AA Change: D552N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: D552N

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: D517N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably damaging
Transcript: ENSMUST00000216286
AA Change: D524N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1135 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 A T 3: 59,784,640 (GRCm39) H371L probably damaging Het
Atad5 T C 11: 80,002,382 (GRCm39) V1058A probably benign Het
Baiap2l2 T C 15: 79,155,783 (GRCm39) H97R probably damaging Het
Bax A G 7: 45,111,315 (GRCm39) S184P probably damaging Het
Bsph1 T G 7: 13,184,840 (GRCm39) M1R probably null Het
Cbln2 A G 18: 86,731,273 (GRCm39) D27G probably benign Het
Cntnap3 G A 13: 65,051,572 (GRCm39) A28V probably damaging Het
Col6a3 C A 1: 90,715,938 (GRCm39) R1641L unknown Het
Dhrs3 T G 4: 144,620,134 (GRCm39) I17S probably benign Het
Ep300 T C 15: 81,527,418 (GRCm39) probably benign Het
Epb41 T C 4: 131,664,717 (GRCm39) probably benign Het
Fat4 A T 3: 39,064,423 (GRCm39) E4793V probably damaging Het
Fbxw22 T G 9: 109,232,156 (GRCm39) K80N probably damaging Het
Fbxw24 T C 9: 109,436,066 (GRCm39) E322G probably benign Het
Fcgbpl1 A G 7: 27,855,994 (GRCm39) D1927G probably damaging Het
Fndc7 T C 3: 108,763,724 (GRCm39) I639V possibly damaging Het
Folh1 T C 7: 86,383,328 (GRCm39) Y473C probably damaging Het
Foxb2 T A 19: 16,850,131 (GRCm39) M292L probably benign Het
Gapvd1 A G 2: 34,605,265 (GRCm39) S41P probably damaging Het
Gmds A T 13: 32,101,704 (GRCm39) probably null Het
Gp6 G T 7: 4,371,899 (GRCm39) A302D probably damaging Het
Hmgcr A T 13: 96,803,171 (GRCm39) M8K probably benign Het
Itpripl2 C T 7: 118,089,092 (GRCm39) R489Q probably damaging Het
Kmo T C 1: 175,474,760 (GRCm39) V175A possibly damaging Het
Lce1i C T 3: 92,684,988 (GRCm39) G63S unknown Het
Lrp1b T C 2: 41,298,354 (GRCm39) Q155R probably damaging Het
Mdm1 T C 10: 117,995,588 (GRCm39) S541P possibly damaging Het
Oga T C 19: 45,765,445 (GRCm39) T121A probably benign Het
Or1j10 A G 2: 36,267,129 (GRCm39) T114A probably benign Het
Or2ak6 T A 11: 58,592,877 (GRCm39) F117I probably damaging Het
Or5bw2 T C 7: 6,573,824 (GRCm39) I278T possibly damaging Het
Or5h17 A T 16: 58,820,569 (GRCm39) I174L probably benign Het
Ppp4r1 C T 17: 66,110,856 (GRCm39) Q21* probably null Het
Ryr2 T A 13: 11,570,334 (GRCm39) T4930S possibly damaging Het
Scart2 T A 7: 139,829,036 (GRCm39) C232S probably damaging Het
Siae G A 9: 37,528,219 (GRCm39) G64D probably benign Het
Slc14a2 T C 18: 78,252,282 (GRCm39) M10V possibly damaging Het
Ssrp1 C G 2: 84,874,669 (GRCm39) D496E probably damaging Het
Steap2 A G 5: 5,725,912 (GRCm39) S371P probably damaging Het
Taf6l G A 19: 8,761,294 (GRCm39) R24W probably damaging Het
Tbkbp1 T C 11: 97,039,555 (GRCm39) Q118R probably damaging Het
Tln2 C T 9: 67,241,602 (GRCm39) G1001E possibly damaging Het
Tm2d3 A G 7: 65,348,872 (GRCm39) N184D probably damaging Het
Tmprss2 A T 16: 97,392,071 (GRCm39) W131R probably null Het
Ube2d2a A G 18: 35,903,531 (GRCm39) probably benign Het
Unc13d A G 11: 115,954,480 (GRCm39) Y1043H probably benign Het
Usp34 T A 11: 23,407,975 (GRCm39) I2600K probably damaging Het
Vmn1r198 A G 13: 22,539,168 (GRCm39) Y218C probably damaging Het
Vmn2r8 T C 5: 108,950,106 (GRCm39) Y247C probably damaging Het
Wdr59 A T 8: 112,192,463 (GRCm39) N699K probably damaging Het
Zcchc2 T C 1: 105,951,402 (GRCm39) V579A probably benign Het
Zfhx3 A T 8: 109,682,623 (GRCm39) Q3354L unknown Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 86,367,632 (GRCm39) missense probably damaging 1.00
IGL01938:Neto2 APN 8 86,417,484 (GRCm39) missense probably benign 0.00
IGL02238:Neto2 APN 8 86,396,292 (GRCm39) missense probably damaging 0.99
IGL02605:Neto2 APN 8 86,390,064 (GRCm39) splice site probably benign
IGL02813:Neto2 APN 8 86,417,515 (GRCm39) missense probably benign
R0138:Neto2 UTSW 8 86,367,673 (GRCm39) missense possibly damaging 0.72
R1934:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R2402:Neto2 UTSW 8 86,417,541 (GRCm39) missense probably benign 0.00
R2423:Neto2 UTSW 8 86,396,396 (GRCm39) missense probably damaging 1.00
R3821:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3822:Neto2 UTSW 8 86,389,924 (GRCm39) nonsense probably null
R3883:Neto2 UTSW 8 86,389,894 (GRCm39) missense probably damaging 1.00
R3939:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3940:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R3941:Neto2 UTSW 8 86,400,747 (GRCm39) missense probably damaging 0.99
R4433:Neto2 UTSW 8 86,367,712 (GRCm39) missense probably damaging 1.00
R4668:Neto2 UTSW 8 86,367,691 (GRCm39) missense probably damaging 1.00
R4675:Neto2 UTSW 8 86,396,333 (GRCm39) missense probably damaging 1.00
R4908:Neto2 UTSW 8 86,396,393 (GRCm39) missense probably damaging 0.99
R5459:Neto2 UTSW 8 86,397,112 (GRCm39) missense probably benign 0.35
R5471:Neto2 UTSW 8 86,367,389 (GRCm39) missense probably benign 0.41
R5544:Neto2 UTSW 8 86,374,506 (GRCm39) missense possibly damaging 0.94
R6083:Neto2 UTSW 8 86,367,214 (GRCm39) missense probably benign 0.00
R6339:Neto2 UTSW 8 86,367,187 (GRCm39) missense probably benign 0.33
R6381:Neto2 UTSW 8 86,369,138 (GRCm39) missense probably damaging 0.99
R6572:Neto2 UTSW 8 86,397,033 (GRCm39) missense possibly damaging 0.96
R6593:Neto2 UTSW 8 86,396,175 (GRCm39) missense probably damaging 1.00
R6662:Neto2 UTSW 8 86,389,844 (GRCm39) missense probably damaging 1.00
R6881:Neto2 UTSW 8 86,367,185 (GRCm39) missense probably damaging 1.00
R6950:Neto2 UTSW 8 86,397,072 (GRCm39) missense probably damaging 1.00
R7121:Neto2 UTSW 8 86,397,020 (GRCm39) splice site probably null
R7754:Neto2 UTSW 8 86,396,329 (GRCm39) missense probably damaging 0.98
R7755:Neto2 UTSW 8 86,396,285 (GRCm39) missense probably damaging 1.00
R8682:Neto2 UTSW 8 86,367,295 (GRCm39) missense probably benign 0.01
R9326:Neto2 UTSW 8 86,369,063 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACAGATGATGCCTTCTTTC -3'
(R):5'- ATGATTTTGCACAACCACAGC -3'

Sequencing Primer
(F):5'- AACAGATGATGCCTTCTTTCCACTG -3'
(R):5'- GATTTTGCACAACCACAGCCAATG -3'
Posted On 2016-10-24