Incidental Mutation 'R5571:Neto2'
ID435672
Institutional Source Beutler Lab
Gene Symbol Neto2
Ensembl Gene ENSMUSG00000036902
Gene Nameneuropilin (NRP) and tolloid (TLL)-like 2
Synonyms
MMRRC Submission 044395-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R5571 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location85636588-85700924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85640544 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 524 (D524N)
Ref Sequence ENSEMBL: ENSMUSP00000150062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109686] [ENSMUST00000209479] [ENSMUST00000216286]
Predicted Effect probably damaging
Transcript: ENSMUST00000109686
AA Change: D552N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105308
Gene: ENSMUSG00000036902
AA Change: D552N

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
CUB 80 194 2.56e-40 SMART
CUB 205 320 9.11e-5 SMART
LDLa 324 361 5.73e-5 SMART
transmembrane domain 374 396 N/A INTRINSIC
coiled coil region 432 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209259
Predicted Effect probably damaging
Transcript: ENSMUST00000209479
AA Change: D517N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215046
Predicted Effect probably damaging
Transcript: ENSMUST00000216286
AA Change: D524N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1135 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 92.9%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a predicted transmembrane protein containing two extracellular CUB domains followed by a low-density lipoprotein class A (LDLa) domain. A similar gene in rats encodes a protein that modulates glutamate signaling in the brain by regulating kainate receptor function. Expression of this gene may be a biomarker for proliferating infantile hemangiomas. A pseudogene of this gene is located on the long arm of chromosome 8. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null mutation show normal brain morphology and kainate receptor mediated excitatory postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,249,123 C232S probably damaging Het
9530053A07Rik A G 7: 28,156,569 D1927G probably damaging Het
Atad5 T C 11: 80,111,556 V1058A probably benign Het
Baiap2l2 T C 15: 79,271,583 H97R probably damaging Het
Bax A G 7: 45,461,891 S184P probably damaging Het
Bsph1 T G 7: 13,450,915 M1R probably null Het
Cbln2 A G 18: 86,713,148 D27G probably benign Het
Cntnap3 G A 13: 64,903,758 A28V probably damaging Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Dhrs3 T G 4: 144,893,564 I17S probably benign Het
Ep300 T C 15: 81,643,217 probably benign Het
Epb41 T C 4: 131,937,406 probably benign Het
Fat4 A T 3: 39,010,274 E4793V probably damaging Het
Fbxw22 T G 9: 109,403,088 K80N probably damaging Het
Fbxw24 T C 9: 109,606,998 E322G probably benign Het
Fndc7 T C 3: 108,856,408 I639V possibly damaging Het
Folh1 T C 7: 86,734,120 Y473C probably damaging Het
Foxb2 T A 19: 16,872,767 M292L probably benign Het
Gapvd1 A G 2: 34,715,253 S41P probably damaging Het
Gm8298 A T 3: 59,877,219 H371L probably damaging Het
Gmds A T 13: 31,917,721 probably null Het
Gp6 G T 7: 4,368,900 A302D probably damaging Het
Hmgcr A T 13: 96,666,663 M8K probably benign Het
Itpripl2 C T 7: 118,489,869 R489Q probably damaging Het
Kmo T C 1: 175,647,194 V175A possibly damaging Het
Lce1i C T 3: 92,777,681 G63S unknown Het
Lrp1b T C 2: 41,408,342 Q155R probably damaging Het
Mdm1 T C 10: 118,159,683 S541P possibly damaging Het
Mgea5 T C 19: 45,777,006 T121A probably benign Het
Olfr1350 T C 7: 6,570,825 I278T possibly damaging Het
Olfr183 A T 16: 59,000,206 I174L probably benign Het
Olfr319 T A 11: 58,702,051 F117I probably damaging Het
Olfr338 A G 2: 36,377,117 T114A probably benign Het
Ppp4r1 C T 17: 65,803,861 Q21* probably null Het
Ryr2 T A 13: 11,555,448 T4930S possibly damaging Het
Siae G A 9: 37,616,923 G64D probably benign Het
Slc14a2 T C 18: 78,209,067 M10V possibly damaging Het
Ssrp1 C G 2: 85,044,325 D496E probably damaging Het
Steap2 A G 5: 5,675,912 S371P probably damaging Het
Taf6l G A 19: 8,783,930 R24W probably damaging Het
Tbkbp1 T C 11: 97,148,729 Q118R probably damaging Het
Tln2 C T 9: 67,334,320 G1001E possibly damaging Het
Tm2d3 A G 7: 65,699,124 N184D probably damaging Het
Tmprss2 A T 16: 97,590,871 W131R probably null Het
Ube2d2a A G 18: 35,770,478 probably benign Het
Unc13d A G 11: 116,063,654 Y1043H probably benign Het
Usp34 T A 11: 23,457,975 I2600K probably damaging Het
Vmn1r198 A G 13: 22,354,998 Y218C probably damaging Het
Vmn2r8 T C 5: 108,802,240 Y247C probably damaging Het
Wdr59 A T 8: 111,465,831 N699K probably damaging Het
Zcchc2 T C 1: 106,023,672 V579A probably benign Het
Zfhx3 A T 8: 108,955,991 Q3354L unknown Het
Other mutations in Neto2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Neto2 APN 8 85641003 missense probably damaging 1.00
IGL01938:Neto2 APN 8 85690855 missense probably benign 0.00
IGL02238:Neto2 APN 8 85669663 missense probably damaging 0.99
IGL02605:Neto2 APN 8 85663435 splice site probably benign
IGL02813:Neto2 APN 8 85690886 missense probably benign
R0138:Neto2 UTSW 8 85641044 missense possibly damaging 0.72
R1934:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R2402:Neto2 UTSW 8 85690912 missense probably benign 0.00
R2423:Neto2 UTSW 8 85669767 missense probably damaging 1.00
R3821:Neto2 UTSW 8 85663295 nonsense probably null
R3822:Neto2 UTSW 8 85663295 nonsense probably null
R3883:Neto2 UTSW 8 85663265 missense probably damaging 1.00
R3939:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3940:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R3941:Neto2 UTSW 8 85674118 missense probably damaging 0.99
R4433:Neto2 UTSW 8 85641083 missense probably damaging 1.00
R4668:Neto2 UTSW 8 85641062 missense probably damaging 1.00
R4675:Neto2 UTSW 8 85669704 missense probably damaging 1.00
R4908:Neto2 UTSW 8 85669764 missense probably damaging 0.99
R5459:Neto2 UTSW 8 85670483 missense probably benign 0.35
R5471:Neto2 UTSW 8 85640760 missense probably benign 0.41
R5544:Neto2 UTSW 8 85647877 missense possibly damaging 0.94
R6083:Neto2 UTSW 8 85640585 missense probably benign 0.00
R6339:Neto2 UTSW 8 85640558 missense probably benign 0.33
R6381:Neto2 UTSW 8 85642509 missense probably damaging 0.99
R6572:Neto2 UTSW 8 85670404 missense possibly damaging 0.96
R6593:Neto2 UTSW 8 85669546 missense probably damaging 1.00
R6662:Neto2 UTSW 8 85663215 missense probably damaging 1.00
R6881:Neto2 UTSW 8 85640556 missense probably damaging 1.00
R6950:Neto2 UTSW 8 85670443 missense probably damaging 1.00
R7121:Neto2 UTSW 8 85670391 splice site probably null
R7754:Neto2 UTSW 8 85669700 missense probably damaging 0.98
R7755:Neto2 UTSW 8 85669656 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAACAGATGATGCCTTCTTTC -3'
(R):5'- ATGATTTTGCACAACCACAGC -3'

Sequencing Primer
(F):5'- AACAGATGATGCCTTCTTTCCACTG -3'
(R):5'- GATTTTGCACAACCACAGCCAATG -3'
Posted On2016-10-24