Mutagenetix > Incidental Mutations

Incidental Mutation 'R5571:Mgea5'

435699

Institutional Source

Beutler Lab

Gene Symbol

Mgea5

Ensembl Gene

ENSMUSG00000025220

Gene Name

meningioma expressed antigen 5 (hyaluronidase)

Synonyms

2810009A20Rik, Hy5, 5830447M11Rik, 4833427O07Rik

MMRRC Submission

044395-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5571 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45750261-45783520 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 45777006 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 121 (T121A)

Ref Sequence

ENSEMBL: ENSMUSP00000026243 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026243]

Predicted Effect

probably benign
Transcript: ENSMUST00000026243
AA Change: T121A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026243
Gene: ENSMUSG00000025220
AA Change: T121A

Domain	Start	End	E-Value	Type
low complexity region	44	57	N/A	INTRINSIC
Pfam:NAGidase	62	361	2.5e-84	PFAM
low complexity region	453	458	N/A	INTRINSIC
PDB:4BMH\|A	700	915	1e-13	PDB
SCOP:d1cjwa_	715	916	1e-3	SMART

Meta Mutation Damage Score

0.0742

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 92.9%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The dynamic modification of cytoplasmic and nuclear proteins by O-linked N-acetylglucosamine (O-GlcNAc) addition and removal on serine and threonine residues is catalyzed by OGT (MIM 300255), which adds O-GlcNAc, and MGEA5, a glycosidase that removes O-GlcNAc modifications (Gao et al., 2001 [PubMed 11148210]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit perinatal lethality associated with a developmental delay and respiratory failure. Mouse embryonic fibroblasts exhibit proliferative and mitotic defects, frequent cytokinesis failure, and loss of genomic stability. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5830411N06Rik	T	A	7: 140,249,123	C232S	probably damaging	Het
9530053A07Rik	A	G	7: 28,156,569	D1927G	probably damaging	Het
Atad5	T	C	11: 80,111,556	V1058A	probably benign	Het
Baiap2l2	T	C	15: 79,271,583	H97R	probably damaging	Het
Bax	A	G	7: 45,461,891	S184P	probably damaging	Het
Bsph1	T	G	7: 13,450,915	M1R	probably null	Het
Cbln2	A	G	18: 86,713,148	D27G	probably benign	Het
Cntnap3	G	A	13: 64,903,758	A28V	probably damaging	Het
Col6a3	C	A	1: 90,788,216	R1641L	unknown	Het
Dhrs3	T	G	4: 144,893,564	I17S	probably benign	Het
Ep300	T	C	15: 81,643,217		probably benign	Het
Epb41	T	C	4: 131,937,406		probably benign	Het
Fat4	A	T	3: 39,010,274	E4793V	probably damaging	Het
Fbxw22	T	G	9: 109,403,088	K80N	probably damaging	Het
Fbxw24	T	C	9: 109,606,998	E322G	probably benign	Het
Fndc7	T	C	3: 108,856,408	I639V	possibly damaging	Het
Folh1	T	C	7: 86,734,120	Y473C	probably damaging	Het
Foxb2	T	A	19: 16,872,767	M292L	probably benign	Het
Gapvd1	A	G	2: 34,715,253	S41P	probably damaging	Het
Gm8298	A	T	3: 59,877,219	H371L	probably damaging	Het
Gmds	A	T	13: 31,917,721		probably null	Het
Gp6	G	T	7: 4,368,900	A302D	probably damaging	Het
Hmgcr	A	T	13: 96,666,663	M8K	probably benign	Het
Itpripl2	C	T	7: 118,489,869	R489Q	probably damaging	Het
Kmo	T	C	1: 175,647,194	V175A	possibly damaging	Het
Lce1i	C	T	3: 92,777,681	G63S	unknown	Het
Lrp1b	T	C	2: 41,408,342	Q155R	probably damaging	Het
Mdm1	T	C	10: 118,159,683	S541P	possibly damaging	Het
Neto2	C	T	8: 85,640,544	D524N	probably damaging	Het
Olfr1350	T	C	7: 6,570,825	I278T	possibly damaging	Het
Olfr183	A	T	16: 59,000,206	I174L	probably benign	Het
Olfr319	T	A	11: 58,702,051	F117I	probably damaging	Het
Olfr338	A	G	2: 36,377,117	T114A	probably benign	Het
Ppp4r1	C	T	17: 65,803,861	Q21*	probably null	Het
Ryr2	T	A	13: 11,555,448	T4930S	possibly damaging	Het
Siae	G	A	9: 37,616,923	G64D	probably benign	Het
Slc14a2	T	C	18: 78,209,067	M10V	possibly damaging	Het
Ssrp1	C	G	2: 85,044,325	D496E	probably damaging	Het
Steap2	A	G	5: 5,675,912	S371P	probably damaging	Het
Taf6l	G	A	19: 8,783,930	R24W	probably damaging	Het
Tbkbp1	T	C	11: 97,148,729	Q118R	probably damaging	Het
Tln2	C	T	9: 67,334,320	G1001E	possibly damaging	Het
Tm2d3	A	G	7: 65,699,124	N184D	probably damaging	Het
Tmprss2	A	T	16: 97,590,871	W131R	probably null	Het
Ube2d2a	A	G	18: 35,770,478		probably benign	Het
Unc13d	A	G	11: 116,063,654	Y1043H	probably benign	Het
Usp34	T	A	11: 23,457,975	I2600K	probably damaging	Het
Vmn1r198	A	G	13: 22,354,998	Y218C	probably damaging	Het
Vmn2r8	T	C	5: 108,802,240	Y247C	probably damaging	Het
Wdr59	A	T	8: 111,465,831	N699K	probably damaging	Het
Zcchc2	T	C	1: 106,023,672	V579A	probably benign	Het
Zfhx3	A	T	8: 108,955,991	Q3354L	unknown	Het

Other mutations in Mgea5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00671:Mgea5	APN	19	45765540	missense	possibly damaging	0.89
IGL01845:Mgea5	APN	19	45767862	missense	probably benign	0.00
IGL02039:Mgea5	APN	19	45773703	missense	probably damaging	0.98
IGL02428:Mgea5	APN	19	45765501	missense	probably damaging	1.00
IGL02581:Mgea5	APN	19	45752191	missense	possibly damaging	0.53
IGL02971:Mgea5	APN	19	45762243	missense	probably damaging	1.00
R0127:Mgea5	UTSW	19	45771888	missense	probably damaging	1.00
R0815:Mgea5	UTSW	19	45782986	missense	probably benign	0.00
R0863:Mgea5	UTSW	19	45782986	missense	probably benign	0.00
R1127:Mgea5	UTSW	19	45752155	nonsense	probably null
R1501:Mgea5	UTSW	19	45778640	missense	probably null	1.00
R1514:Mgea5	UTSW	19	45776931	missense	probably damaging	1.00
R1586:Mgea5	UTSW	19	45776910	missense	possibly damaging	0.94
R1716:Mgea5	UTSW	19	45752174	missense	probably benign	0.35
R1755:Mgea5	UTSW	19	45758406	missense	possibly damaging	0.93
R1774:Mgea5	UTSW	19	45776984	missense	probably benign	0.37
R2152:Mgea5	UTSW	19	45758022	nonsense	probably null
R4403:Mgea5	UTSW	19	45778639	missense	probably damaging	1.00
R4664:Mgea5	UTSW	19	45771945	missense	probably benign	0.15
R4971:Mgea5	UTSW	19	45770046	splice site	probably null
R5377:Mgea5	UTSW	19	45758022	nonsense	probably null
R5639:Mgea5	UTSW	19	45776999	missense	probably damaging	1.00
R5665:Mgea5	UTSW	19	45776997	missense	probably benign	0.00
R5776:Mgea5	UTSW	19	45771924	missense	probably damaging	1.00
R6050:Mgea5	UTSW	19	45765480	missense	possibly damaging	0.95
R6054:Mgea5	UTSW	19	45776132	missense	probably damaging	1.00
R6317:Mgea5	UTSW	19	45771680	critical splice donor site	probably null
R6410:Mgea5	UTSW	19	45776045	splice site	probably null
R6990:Mgea5	UTSW	19	45767476	missense	probably benign	0.00
R7103:Mgea5	UTSW	19	45783166	start gained	probably benign
R7340:Mgea5	UTSW	19	45767456	nonsense	probably null
R7422:Mgea5	UTSW	19	45776175	frame shift	probably null
R7437:Mgea5	UTSW	19	45778607	missense	possibly damaging	0.76
R7490:Mgea5	UTSW	19	45767447	nonsense	probably null
R7741:Mgea5	UTSW	19	45776062	missense	probably damaging	1.00
R7823:Mgea5	UTSW	19	45776915	missense	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- CTGCTTCTCTACCCAAAACTTGAG -3'
(R):5'- AGCCTGCTATCACGTTAGGTAG -3'

Sequencing Primer
(F):5'- ACCCAAAACTTGAGTTCCTTTTAAC -3'
(R):5'- CATCACTATATAGCCCAGGTTGG -3'

Posted On

2016-10-24