Incidental Mutation 'R5572:Clca3b'
ID435714
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
MMRRC Submission 043266-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5572 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144827309 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 654 (D654G)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect probably damaging
Transcript: ENSMUST00000159989
AA Change: D654G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: D654G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,264,567 D167V probably damaging Het
Abcb1a C T 5: 8,715,108 probably null Het
Abcd4 T C 12: 84,606,276 D380G probably benign Het
Actr3b T A 5: 25,809,888 D68E probably benign Het
Apol10a T C 15: 77,488,634 S157P probably damaging Het
Arap3 A T 18: 37,991,066 I327N probably damaging Het
Arnt G T 3: 95,474,704 V198L possibly damaging Het
Baiap3 T A 17: 25,251,475 D86V possibly damaging Het
Bcl9l G T 9: 44,500,798 R27L possibly damaging Het
C1qc T C 4: 136,892,462 Y34C probably benign Het
C1rb T C 6: 124,580,799 S632P probably benign Het
C3 A G 17: 57,224,673 S284P probably damaging Het
Cfap44 T G 16: 44,481,305 V1802G possibly damaging Het
Cfhr1 A G 1: 139,556,427 V117A possibly damaging Het
Col17a1 A T 19: 47,650,729 S1126T probably benign Het
Cts3 T A 13: 61,564,968 I313F probably damaging Het
Egfl7 T C 2: 26,591,691 V6A possibly damaging Het
Eif2s3y G A Y: 1,016,631 D272N probably damaging Het
Fam129a T C 1: 151,709,190 S513P probably benign Het
Foxp4 A G 17: 47,880,879 V111A unknown Het
Hmcn2 A T 2: 31,414,525 probably null Het
Hmcn2 G A 2: 31,414,526 probably null Het
Igsf11 C T 16: 39,024,932 R283C probably damaging Het
Il1a A G 2: 129,307,918 Y21H possibly damaging Het
Il6ra A T 3: 89,871,282 V420D probably damaging Het
Kdm5a T C 6: 120,412,375 V921A possibly damaging Het
Kirrel3 G A 9: 35,000,948 A196T probably damaging Het
Klra1 T A 6: 130,372,839 D212V possibly damaging Het
N4bp2l2 G A 5: 150,662,290 T75I probably benign Het
Nnmt A G 9: 48,592,147 L193P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ntm A G 9: 29,014,216 I191T probably damaging Het
Olfr318 A G 11: 58,720,229 V273A probably benign Het
Olfr607 A C 7: 103,460,698 L170R probably benign Het
Olfr652 A T 7: 104,564,994 T258S probably benign Het
Pam A C 1: 97,854,744 probably benign Het
Pomk T A 8: 25,983,190 H245L possibly damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rasip1 G T 7: 45,636,729 R792L probably benign Het
Ret T C 6: 118,155,431 Y1016C probably damaging Het
Rhbdd1 A T 1: 82,340,810 N138I possibly damaging Het
Snx13 T G 12: 35,103,120 V383G probably damaging Het
Syt3 A G 7: 44,390,718 H125R probably benign Het
Tlr6 A T 5: 64,955,018 L182Q probably damaging Het
Tlr9 T C 9: 106,225,637 V709A possibly damaging Het
Tmprss6 T C 15: 78,442,422 Y655C probably damaging Het
Ttn A T 2: 76,853,628 probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Ube3b G A 5: 114,406,179 D546N probably damaging Het
Ugt2b36 A G 5: 87,089,482 V188A possibly damaging Het
Usp29 A G 7: 6,962,192 I345V probably benign Het
Vmn2r78 A G 7: 86,915,512 K55R probably benign Het
Wdsub1 A G 2: 59,862,707 F288L possibly damaging Het
Zan C T 5: 137,394,431 V4601M unknown Het
Zbtb8b T C 4: 129,428,541 K376E probably damaging Het
Zfp619 A T 7: 39,535,239 Y231F probably benign Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R5845:Clca3b UTSW 3 144825316 missense possibly damaging 0.46
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8181:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
R8546:Clca3b UTSW 3 144827397 missense probably damaging 0.99
R8716:Clca3b UTSW 3 144844594 missense probably benign 0.14
R8804:Clca3b UTSW 3 144839137 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCGAGTTCCTTCCATGGTTCA -3'
(R):5'- TCGAGCAAGAAGTCCCACC -3'

Sequencing Primer
(F):5'- AAAAGGGATGCCTCCGC -3'
(R):5'- CACACTCCCAGTCATCGC -3'
Posted On2016-10-24