Incidental Mutation 'R5572:Ube3b'
ID 435721
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission 043266-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5572 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 114544240 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 546 (D546N)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably damaging
Transcript: ENSMUST00000074002
AA Change: D546N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: D546N

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183408
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Meta Mutation Damage Score 0.3543 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,765,108 (GRCm39) probably null Het
Abcd4 T C 12: 84,653,050 (GRCm39) D380G probably benign Het
Actr3b T A 5: 26,014,886 (GRCm39) D68E probably benign Het
Apol10a T C 15: 77,372,834 (GRCm39) S157P probably damaging Het
Arap3 A T 18: 38,124,119 (GRCm39) I327N probably damaging Het
Arnt G T 3: 95,382,015 (GRCm39) V198L possibly damaging Het
Baiap3 T A 17: 25,470,449 (GRCm39) D86V possibly damaging Het
Bcl9l G T 9: 44,412,095 (GRCm39) R27L possibly damaging Het
Bltp2 A T 11: 78,155,393 (GRCm39) D167V probably damaging Het
C1qc T C 4: 136,619,773 (GRCm39) Y34C probably benign Het
C1rb T C 6: 124,557,758 (GRCm39) S632P probably benign Het
C3 A G 17: 57,531,673 (GRCm39) S284P probably damaging Het
Cfap44 T G 16: 44,301,668 (GRCm39) V1802G possibly damaging Het
Cfhr1 A G 1: 139,484,165 (GRCm39) V117A possibly damaging Het
Clca3b T C 3: 144,533,070 (GRCm39) D654G probably damaging Het
Col17a1 A T 19: 47,639,168 (GRCm39) S1126T probably benign Het
Cts3 T A 13: 61,712,782 (GRCm39) I313F probably damaging Het
Egfl7 T C 2: 26,481,703 (GRCm39) V6A possibly damaging Het
Eif2s3y G A Y: 1,016,631 (GRCm39) D272N probably damaging Het
Foxp4 A G 17: 48,191,804 (GRCm39) V111A unknown Het
Hmcn2 A T 2: 31,304,537 (GRCm39) probably null Het
Hmcn2 G A 2: 31,304,538 (GRCm39) probably null Het
Igsf11 C T 16: 38,845,294 (GRCm39) R283C probably damaging Het
Il1a A G 2: 129,149,838 (GRCm39) Y21H possibly damaging Het
Il6ra A T 3: 89,778,589 (GRCm39) V420D probably damaging Het
Kdm5a T C 6: 120,389,336 (GRCm39) V921A possibly damaging Het
Kirrel3 G A 9: 34,912,244 (GRCm39) A196T probably damaging Het
Klra1 T A 6: 130,349,802 (GRCm39) D212V possibly damaging Het
N4bp2l2 G A 5: 150,585,755 (GRCm39) T75I probably benign Het
Niban1 T C 1: 151,584,941 (GRCm39) S513P probably benign Het
Nnmt A G 9: 48,503,447 (GRCm39) L193P probably damaging Het
Npdc1 G A 2: 25,298,957 (GRCm39) D284N probably damaging Het
Ntm A G 9: 28,925,512 (GRCm39) I191T probably damaging Het
Or2ak5 A G 11: 58,611,055 (GRCm39) V273A probably benign Het
Or52d13 A C 7: 103,109,905 (GRCm39) L170R probably benign Het
Or52h7 A T 7: 104,214,201 (GRCm39) T258S probably benign Het
Pam A C 1: 97,782,469 (GRCm39) probably benign Het
Pomk T A 8: 26,473,218 (GRCm39) H245L possibly damaging Het
Rapgef4 G A 2: 71,864,464 (GRCm39) probably null Het
Rasip1 G T 7: 45,286,153 (GRCm39) R792L probably benign Het
Ret T C 6: 118,132,392 (GRCm39) Y1016C probably damaging Het
Rhbdd1 A T 1: 82,318,531 (GRCm39) N138I possibly damaging Het
Snx13 T G 12: 35,153,119 (GRCm39) V383G probably damaging Het
Syt3 A G 7: 44,040,142 (GRCm39) H125R probably benign Het
Tlr6 A T 5: 65,112,361 (GRCm39) L182Q probably damaging Het
Tlr9 T C 9: 106,102,836 (GRCm39) V709A possibly damaging Het
Tmprss6 T C 15: 78,326,622 (GRCm39) Y655C probably damaging Het
Ttn A T 2: 76,683,972 (GRCm39) probably benign Het
Ube3a T C 7: 58,938,525 (GRCm39) I761T probably damaging Het
Ugt2b36 A G 5: 87,237,341 (GRCm39) V188A possibly damaging Het
Usp29 A G 7: 6,965,191 (GRCm39) I345V probably benign Het
Vmn2r78 A G 7: 86,564,720 (GRCm39) K55R probably benign Het
Wdsub1 A G 2: 59,693,051 (GRCm39) F288L possibly damaging Het
Zan C T 5: 137,392,693 (GRCm39) V4601M unknown Het
Zbtb8b T C 4: 129,322,334 (GRCm39) K376E probably damaging Het
Zfp619 A T 7: 39,184,663 (GRCm39) Y231F probably benign Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
R9710:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CCTTTAAACCCCAGGAGCTC -3'
(R):5'- AGTCAGGATTCCCTACCACCTC -3'

Sequencing Primer
(F):5'- TGCCCCAGCATAACTCCAAGG -3'
(R):5'- CCACCTCTGGTAAATGATAAAGCTG -3'
Posted On 2016-10-24