Mutagenetix > Incidental Mutation

Incidental Mutation 'R5572:Ube3b'

435721

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

MMRRC Submission

043266-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5572 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114406179 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 546 (D546N)

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

probably damaging
Transcript: ENSMUST00000074002
AA Change: D546N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: D546N

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150630

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183408

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Meta Mutation Damage Score

0.3543

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.2%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 56 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	A	T	11: 78,264,567	D167V	probably damaging	Het
Abcb1a	C	T	5: 8,715,108		probably null	Het
Abcd4	T	C	12: 84,606,276	D380G	probably benign	Het
Actr3b	T	A	5: 25,809,888	D68E	probably benign	Het
Apol10a	T	C	15: 77,488,634	S157P	probably damaging	Het
Arap3	A	T	18: 37,991,066	I327N	probably damaging	Het
Arnt	G	T	3: 95,474,704	V198L	possibly damaging	Het
Baiap3	T	A	17: 25,251,475	D86V	possibly damaging	Het
Bcl9l	G	T	9: 44,500,798	R27L	possibly damaging	Het
C1qc	T	C	4: 136,892,462	Y34C	probably benign	Het
C1rb	T	C	6: 124,580,799	S632P	probably benign	Het
C3	A	G	17: 57,224,673	S284P	probably damaging	Het
Cfap44	T	G	16: 44,481,305	V1802G	possibly damaging	Het
Cfhr1	A	G	1: 139,556,427	V117A	possibly damaging	Het
Clca3b	T	C	3: 144,827,309	D654G	probably damaging	Het
Col17a1	A	T	19: 47,650,729	S1126T	probably benign	Het
Cts3	T	A	13: 61,564,968	I313F	probably damaging	Het
Egfl7	T	C	2: 26,591,691	V6A	possibly damaging	Het
Eif2s3y	G	A	Y: 1,016,631	D272N	probably damaging	Het
Fam129a	T	C	1: 151,709,190	S513P	probably benign	Het
Foxp4	A	G	17: 47,880,879	V111A	unknown	Het
Hmcn2	A	T	2: 31,414,525		probably null	Het
Hmcn2	G	A	2: 31,414,526		probably null	Het
Igsf11	C	T	16: 39,024,932	R283C	probably damaging	Het
Il1a	A	G	2: 129,307,918	Y21H	possibly damaging	Het
Il6ra	A	T	3: 89,871,282	V420D	probably damaging	Het
Kdm5a	T	C	6: 120,412,375	V921A	possibly damaging	Het
Kirrel3	G	A	9: 35,000,948	A196T	probably damaging	Het
Klra1	T	A	6: 130,372,839	D212V	possibly damaging	Het
N4bp2l2	G	A	5: 150,662,290	T75I	probably benign	Het
Nnmt	A	G	9: 48,592,147	L193P	probably damaging	Het
Npdc1	G	A	2: 25,408,945	D284N	probably damaging	Het
Ntm	A	G	9: 29,014,216	I191T	probably damaging	Het
Olfr318	A	G	11: 58,720,229	V273A	probably benign	Het
Olfr607	A	C	7: 103,460,698	L170R	probably benign	Het
Olfr652	A	T	7: 104,564,994	T258S	probably benign	Het
Pam	A	C	1: 97,854,744		probably benign	Het
Pomk	T	A	8: 25,983,190	H245L	possibly damaging	Het
Rapgef4	G	A	2: 72,034,120		probably null	Het
Rasip1	G	T	7: 45,636,729	R792L	probably benign	Het
Ret	T	C	6: 118,155,431	Y1016C	probably damaging	Het
Rhbdd1	A	T	1: 82,340,810	N138I	possibly damaging	Het
Snx13	T	G	12: 35,103,120	V383G	probably damaging	Het
Syt3	A	G	7: 44,390,718	H125R	probably benign	Het
Tlr6	A	T	5: 64,955,018	L182Q	probably damaging	Het
Tlr9	T	C	9: 106,225,637	V709A	possibly damaging	Het
Tmprss6	T	C	15: 78,442,422	Y655C	probably damaging	Het
Ttn	A	T	2: 76,853,628		probably benign	Het
Ube3a	T	C	7: 59,288,777	I761T	probably damaging	Het
Ugt2b36	A	G	5: 87,089,482	V188A	possibly damaging	Het
Usp29	A	G	7: 6,962,192	I345V	probably benign	Het
Vmn2r78	A	G	7: 86,915,512	K55R	probably benign	Het
Wdsub1	A	G	2: 59,862,707	F288L	possibly damaging	Het
Zan	C	T	5: 137,394,431	V4601M	unknown	Het
Zbtb8b	T	C	4: 129,428,541	K376E	probably damaging	Het
Zfp619	A	T	7: 39,535,239	Y231F	probably benign	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CCTTTAAACCCCAGGAGCTC -3'
(R):5'- AGTCAGGATTCCCTACCACCTC -3'

Sequencing Primer
(F):5'- TGCCCCAGCATAACTCCAAGG -3'
(R):5'- CCACCTCTGGTAAATGATAAAGCTG -3'

Posted On

2016-10-24