Incidental Mutation 'R5572:Klra1'
ID435727
Institutional Source Beutler Lab
Gene Symbol Klra1
Ensembl Gene ENSMUSG00000079853
Gene Namekiller cell lectin-like receptor, subfamily A, member 1
SynonymsLy49o<129>, Ly49A
MMRRC Submission 043266-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R5572 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location130363917-130386874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130372839 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 212 (D212V)
Ref Sequence ENSEMBL: ENSMUSP00000032288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032288]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032288
AA Change: D212V

PolyPhen 2 Score 0.729 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032288
Gene: ENSMUSG00000079853
AA Change: D212V

DomainStartEndE-ValueType
Blast:CLECT 73 118 9e-8 BLAST
CLECT 139 254 4.02e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127570
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,264,567 D167V probably damaging Het
Abcb1a C T 5: 8,715,108 probably null Het
Abcd4 T C 12: 84,606,276 D380G probably benign Het
Actr3b T A 5: 25,809,888 D68E probably benign Het
Apol10a T C 15: 77,488,634 S157P probably damaging Het
Arap3 A T 18: 37,991,066 I327N probably damaging Het
Arnt G T 3: 95,474,704 V198L possibly damaging Het
Baiap3 T A 17: 25,251,475 D86V possibly damaging Het
Bcl9l G T 9: 44,500,798 R27L possibly damaging Het
C1qc T C 4: 136,892,462 Y34C probably benign Het
C1rb T C 6: 124,580,799 S632P probably benign Het
C3 A G 17: 57,224,673 S284P probably damaging Het
Cfap44 T G 16: 44,481,305 V1802G possibly damaging Het
Cfhr1 A G 1: 139,556,427 V117A possibly damaging Het
Clca3b T C 3: 144,827,309 D654G probably damaging Het
Col17a1 A T 19: 47,650,729 S1126T probably benign Het
Cts3 T A 13: 61,564,968 I313F probably damaging Het
Egfl7 T C 2: 26,591,691 V6A possibly damaging Het
Eif2s3y G A Y: 1,016,631 D272N probably damaging Het
Fam129a T C 1: 151,709,190 S513P probably benign Het
Foxp4 A G 17: 47,880,879 V111A unknown Het
Hmcn2 A T 2: 31,414,525 probably null Het
Hmcn2 G A 2: 31,414,526 probably null Het
Igsf11 C T 16: 39,024,932 R283C probably damaging Het
Il1a A G 2: 129,307,918 Y21H possibly damaging Het
Il6ra A T 3: 89,871,282 V420D probably damaging Het
Kdm5a T C 6: 120,412,375 V921A possibly damaging Het
Kirrel3 G A 9: 35,000,948 A196T probably damaging Het
N4bp2l2 G A 5: 150,662,290 T75I probably benign Het
Nnmt A G 9: 48,592,147 L193P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ntm A G 9: 29,014,216 I191T probably damaging Het
Olfr318 A G 11: 58,720,229 V273A probably benign Het
Olfr607 A C 7: 103,460,698 L170R probably benign Het
Olfr652 A T 7: 104,564,994 T258S probably benign Het
Pam A C 1: 97,854,744 probably benign Het
Pomk T A 8: 25,983,190 H245L possibly damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rasip1 G T 7: 45,636,729 R792L probably benign Het
Ret T C 6: 118,155,431 Y1016C probably damaging Het
Rhbdd1 A T 1: 82,340,810 N138I possibly damaging Het
Snx13 T G 12: 35,103,120 V383G probably damaging Het
Syt3 A G 7: 44,390,718 H125R probably benign Het
Tlr6 A T 5: 64,955,018 L182Q probably damaging Het
Tlr9 T C 9: 106,225,637 V709A possibly damaging Het
Tmprss6 T C 15: 78,442,422 Y655C probably damaging Het
Ttn A T 2: 76,853,628 probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Ube3b G A 5: 114,406,179 D546N probably damaging Het
Ugt2b36 A G 5: 87,089,482 V188A possibly damaging Het
Usp29 A G 7: 6,962,192 I345V probably benign Het
Vmn2r78 A G 7: 86,915,512 K55R probably benign Het
Wdsub1 A G 2: 59,862,707 F288L possibly damaging Het
Zan C T 5: 137,394,431 V4601M unknown Het
Zbtb8b T C 4: 129,428,541 K376E probably damaging Het
Zfp619 A T 7: 39,535,239 Y231F probably benign Het
Other mutations in Klra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Klra1 APN 6 130364274 nonsense probably null
IGL01320:Klra1 APN 6 130364261 missense probably benign 0.02
IGL01322:Klra1 APN 6 130364261 missense probably benign 0.02
IGL02149:Klra1 APN 6 130375330 missense probably damaging 1.00
IGL02666:Klra1 APN 6 130364315 missense probably damaging 1.00
IGL02895:Klra1 APN 6 130375240 missense possibly damaging 0.51
R0004:Klra1 UTSW 6 130372873 missense probably damaging 1.00
R0408:Klra1 UTSW 6 130377774 missense probably benign 0.13
R0442:Klra1 UTSW 6 130372872 missense probably damaging 1.00
R0498:Klra1 UTSW 6 130372819 critical splice donor site probably null
R0765:Klra1 UTSW 6 130379092 splice site probably benign
R1761:Klra1 UTSW 6 130372873 missense probably damaging 1.00
R1922:Klra1 UTSW 6 130372865 missense probably benign 0.01
R1987:Klra1 UTSW 6 130377779 missense probably benign
R2882:Klra1 UTSW 6 130377863 splice site probably null
R5054:Klra1 UTSW 6 130375284 missense probably damaging 0.99
R5190:Klra1 UTSW 6 130375278 missense probably damaging 1.00
R5825:Klra1 UTSW 6 130380629 missense probably damaging 1.00
R6784:Klra1 UTSW 6 130372854 missense probably benign 0.00
Z1176:Klra1 UTSW 6 130372851 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCTGAGATGTATGCAGTATTAAGCC -3'
(R):5'- CACAGGAATTTTGGGGAATTACC -3'

Sequencing Primer
(F):5'- ATGCAGTATTAAGCCTCTTTTGG -3'
(R):5'- CCTTCTTGTTCTTCACTAATCAGAG -3'
Posted On2016-10-24