Incidental Mutation 'R5572:Bcl9l'
ID435739
Institutional Source Beutler Lab
Gene Symbol Bcl9l
Ensembl Gene ENSMUSG00000063382
Gene NameB cell CLL/lymphoma 9-like
SynonymsDLNB11
MMRRC Submission 043266-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5572 (G1)
Quality Score208
Status Validated
Chromosome9
Chromosomal Location44482825-44511896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44500798 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 27 (R27L)
Ref Sequence ENSEMBL: ENSMUSP00000151653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074989] [ENSMUST00000218183] [ENSMUST00000218913] [ENSMUST00000220303]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074989
AA Change: R27L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074516
Gene: ENSMUSG00000063382
AA Change: R27L

DomainStartEndE-ValueType
low complexity region 215 234 N/A INTRINSIC
PDB:2XB1|C 236 269 2e-14 PDB
low complexity region 278 292 N/A INTRINSIC
low complexity region 297 325 N/A INTRINSIC
low complexity region 337 376 N/A INTRINSIC
Pfam:BCL9 395 432 2.4e-18 PFAM
low complexity region 490 507 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 590 602 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217898
Predicted Effect possibly damaging
Transcript: ENSMUST00000218183
AA Change: R27L

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218913
AA Change: R27L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220292
Predicted Effect probably benign
Transcript: ENSMUST00000220303
Meta Mutation Damage Score 0.0711 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A T 11: 78,264,567 D167V probably damaging Het
Abcb1a C T 5: 8,715,108 probably null Het
Abcd4 T C 12: 84,606,276 D380G probably benign Het
Actr3b T A 5: 25,809,888 D68E probably benign Het
Apol10a T C 15: 77,488,634 S157P probably damaging Het
Arap3 A T 18: 37,991,066 I327N probably damaging Het
Arnt G T 3: 95,474,704 V198L possibly damaging Het
Baiap3 T A 17: 25,251,475 D86V possibly damaging Het
C1qc T C 4: 136,892,462 Y34C probably benign Het
C1rb T C 6: 124,580,799 S632P probably benign Het
C3 A G 17: 57,224,673 S284P probably damaging Het
Cfap44 T G 16: 44,481,305 V1802G possibly damaging Het
Cfhr1 A G 1: 139,556,427 V117A possibly damaging Het
Clca3b T C 3: 144,827,309 D654G probably damaging Het
Col17a1 A T 19: 47,650,729 S1126T probably benign Het
Cts3 T A 13: 61,564,968 I313F probably damaging Het
Egfl7 T C 2: 26,591,691 V6A possibly damaging Het
Eif2s3y G A Y: 1,016,631 D272N probably damaging Het
Fam129a T C 1: 151,709,190 S513P probably benign Het
Foxp4 A G 17: 47,880,879 V111A unknown Het
Hmcn2 A T 2: 31,414,525 probably null Het
Hmcn2 G A 2: 31,414,526 probably null Het
Igsf11 C T 16: 39,024,932 R283C probably damaging Het
Il1a A G 2: 129,307,918 Y21H possibly damaging Het
Il6ra A T 3: 89,871,282 V420D probably damaging Het
Kdm5a T C 6: 120,412,375 V921A possibly damaging Het
Kirrel3 G A 9: 35,000,948 A196T probably damaging Het
Klra1 T A 6: 130,372,839 D212V possibly damaging Het
N4bp2l2 G A 5: 150,662,290 T75I probably benign Het
Nnmt A G 9: 48,592,147 L193P probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Ntm A G 9: 29,014,216 I191T probably damaging Het
Olfr318 A G 11: 58,720,229 V273A probably benign Het
Olfr607 A C 7: 103,460,698 L170R probably benign Het
Olfr652 A T 7: 104,564,994 T258S probably benign Het
Pam A C 1: 97,854,744 probably benign Het
Pomk T A 8: 25,983,190 H245L possibly damaging Het
Rapgef4 G A 2: 72,034,120 probably null Het
Rasip1 G T 7: 45,636,729 R792L probably benign Het
Ret T C 6: 118,155,431 Y1016C probably damaging Het
Rhbdd1 A T 1: 82,340,810 N138I possibly damaging Het
Snx13 T G 12: 35,103,120 V383G probably damaging Het
Syt3 A G 7: 44,390,718 H125R probably benign Het
Tlr6 A T 5: 64,955,018 L182Q probably damaging Het
Tlr9 T C 9: 106,225,637 V709A possibly damaging Het
Tmprss6 T C 15: 78,442,422 Y655C probably damaging Het
Ttn A T 2: 76,853,628 probably benign Het
Ube3a T C 7: 59,288,777 I761T probably damaging Het
Ube3b G A 5: 114,406,179 D546N probably damaging Het
Ugt2b36 A G 5: 87,089,482 V188A possibly damaging Het
Usp29 A G 7: 6,962,192 I345V probably benign Het
Vmn2r78 A G 7: 86,915,512 K55R probably benign Het
Wdsub1 A G 2: 59,862,707 F288L possibly damaging Het
Zan C T 5: 137,394,431 V4601M unknown Het
Zbtb8b T C 4: 129,428,541 K376E probably damaging Het
Zfp619 A T 7: 39,535,239 Y231F probably benign Het
Other mutations in Bcl9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Bcl9l APN 9 44505627 missense possibly damaging 0.86
IGL00969:Bcl9l APN 9 44508242 missense possibly damaging 0.79
IGL01011:Bcl9l APN 9 44505179 missense possibly damaging 0.85
IGL01396:Bcl9l APN 9 44506824 missense probably damaging 0.99
IGL02015:Bcl9l APN 9 44508801 unclassified probably null
IGL02106:Bcl9l APN 9 44509199 missense probably benign 0.03
IGL02310:Bcl9l APN 9 44509305 missense probably damaging 1.00
IGL02447:Bcl9l APN 9 44507334 missense probably benign 0.09
IGL02534:Bcl9l APN 9 44505739 missense probably benign 0.00
IGL02541:Bcl9l APN 9 44507769 missense probably benign 0.02
IGL02688:Bcl9l APN 9 44505263 missense possibly damaging 0.86
IGL02931:Bcl9l APN 9 44500750 missense probably damaging 0.96
R0098:Bcl9l UTSW 9 44505617 missense probably benign
R0142:Bcl9l UTSW 9 44507112 missense probably benign 0.09
R0193:Bcl9l UTSW 9 44507406 missense probably damaging 1.00
R0227:Bcl9l UTSW 9 44505236 missense possibly damaging 0.96
R0481:Bcl9l UTSW 9 44506682 missense probably benign
R0496:Bcl9l UTSW 9 44509518 missense probably benign 0.00
R1741:Bcl9l UTSW 9 44509689 missense probably damaging 0.99
R1971:Bcl9l UTSW 9 44508699 unclassified probably null
R1976:Bcl9l UTSW 9 44506152 missense possibly damaging 0.76
R4415:Bcl9l UTSW 9 44501879 missense possibly damaging 0.83
R4751:Bcl9l UTSW 9 44506803 missense probably damaging 0.99
R4810:Bcl9l UTSW 9 44508353 missense probably damaging 1.00
R4880:Bcl9l UTSW 9 44508710 missense probably benign 0.01
R4967:Bcl9l UTSW 9 44505068 missense possibly damaging 0.85
R5418:Bcl9l UTSW 9 44505436 missense possibly damaging 0.53
R5658:Bcl9l UTSW 9 44509169 missense probably damaging 1.00
R5812:Bcl9l UTSW 9 44506644 missense probably benign 0.01
R6515:Bcl9l UTSW 9 44507874 splice site probably null
R6670:Bcl9l UTSW 9 44507072 small insertion probably benign
R6682:Bcl9l UTSW 9 44501103 missense possibly damaging 0.91
R6966:Bcl9l UTSW 9 44509388 nonsense probably null
R7171:Bcl9l UTSW 9 44505151 missense probably benign 0.33
R7338:Bcl9l UTSW 9 44508708 missense probably benign
R7448:Bcl9l UTSW 9 44509337 missense probably benign 0.00
R7609:Bcl9l UTSW 9 44505747 missense probably damaging 0.99
R7793:Bcl9l UTSW 9 44508966 missense probably benign 0.00
R7793:Bcl9l UTSW 9 44509697 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGTGGTCTCCAGATAGCAC -3'
(R):5'- CCCTTGAGTGAGCTGAAAGG -3'

Sequencing Primer
(F):5'- GTGGTCTCCAGATAGCACCTCAC -3'
(R):5'- CAGACTTGAGTTGCTAGGTGAGATC -3'
Posted On2016-10-24