Mutagenetix > Incidental Mutation

Incidental Mutation 'R5573:Sptan1'

435761

Institutional Source

Beutler Lab

Gene Symbol

Sptan1

Ensembl Gene

ENSMUSG00000057738

Gene Name

spectrin alpha, non-erythrocytic 1

Synonyms

alpha-fodrin, alphaII-spectrin, Spna2, 2610027H02Rik, Spna-2

MMRRC Submission

043128-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5573 (G1)

Quality Score

221

Status

Not validated

Chromosome

Chromosomal Location

29855572-29921463 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 29876504 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 295 (R295*)

Ref Sequence

ENSEMBL: ENSMUSP00000121116 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046257] [ENSMUST00000095083] [ENSMUST00000100225] [ENSMUST00000113717] [ENSMUST00000113719] [ENSMUST00000113741] [ENSMUST00000129241]

AlphaFold

P16546

Predicted Effect

probably null
Transcript: ENSMUST00000046257
AA Change: R295*

SMART Domains

Protein: ENSMUSP00000047792
Gene: ENSMUSG00000057738
AA Change: R295*

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1635	9.65e-30	SMART
SPEC	1641	1741	2.32e-32	SMART
SPEC	1747	1847	6.98e-36	SMART
SPEC	1853	1953	1.53e-32	SMART
SPEC	1959	2060	6.23e-24	SMART
SPEC	2074	2174	2.08e-11	SMART
SPEC	2188	2289	1.07e-4	SMART
EFh	2307	2335	5.78e-7	SMART
EFh	2350	2378	3.85e-3	SMART
efhand_Ca_insen	2382	2451	6.74e-32	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000095083
AA Change: R295*

SMART Domains

Protein: ENSMUSP00000092697
Gene: ENSMUSG00000057738
AA Change: R295*

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1655	9.65e-30	SMART
SPEC	1661	1761	2.32e-32	SMART
SPEC	1767	1867	6.98e-36	SMART
SPEC	1873	1973	1.53e-32	SMART
SPEC	1979	2080	6.23e-24	SMART
SPEC	2094	2194	2.08e-11	SMART
SPEC	2208	2309	1.07e-4	SMART
EFh	2327	2355	5.78e-7	SMART
EFh	2370	2398	3.85e-3	SMART
efhand_Ca_insen	2402	2471	6.74e-32	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000100225
AA Change: R295*

SMART Domains

Protein: ENSMUSP00000097797
Gene: ENSMUSG00000057738
AA Change: R295*

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1088	1.56e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1094	1230	6.52e-27	SMART
SPEC	1236	1336	1.44e-37	SMART
SPEC	1342	1442	4.43e-29	SMART
SPEC	1448	1548	7.54e-32	SMART
SPEC	1554	1660	2.06e-24	SMART
SPEC	1666	1766	2.32e-32	SMART
SPEC	1772	1872	6.98e-36	SMART
SPEC	1878	1978	1.53e-32	SMART
SPEC	1984	2085	6.23e-24	SMART
SPEC	2099	2199	2.08e-11	SMART
SPEC	2213	2314	1.07e-4	SMART
EFh	2332	2360	5.78e-7	SMART
EFh	2375	2403	3.85e-3	SMART
efhand_Ca_insen	2407	2476	6.74e-32	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113717
AA Change: R295*

SMART Domains

Protein: ENSMUSP00000109346
Gene: ENSMUSG00000057738
AA Change: R295*

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2294	1.07e-4	SMART
EFh	2312	2340	5.78e-7	SMART
EFh	2355	2383	3.85e-3	SMART
efhand_Ca_insen	2387	2456	6.74e-32	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000113719
AA Change: R295*

SMART Domains

Protein: ENSMUSP00000109348
Gene: ENSMUSG00000057738
AA Change: R295*

Domain	Start	End	E-Value	Type
SPEC	47	146	2.1e-30	SMART
SPEC	152	252	2.6e-35	SMART
SPEC	258	358	4.93e-36	SMART
SPEC	364	464	1.08e-27	SMART
SPEC	470	570	9.01e-30	SMART
SPEC	576	675	3.52e-32	SMART
SPEC	681	781	2.15e-36	SMART
SPEC	787	887	2.45e-40	SMART
SPEC	893	1068	1.18e-24	SMART
SH3	970	1025	8.24e-18	SMART
SPEC	1074	1210	6.52e-27	SMART
SPEC	1216	1316	1.44e-37	SMART
SPEC	1322	1422	4.43e-29	SMART
SPEC	1428	1528	7.54e-32	SMART
SPEC	1534	1640	2.06e-24	SMART
SPEC	1646	1746	2.32e-32	SMART
SPEC	1752	1852	6.98e-36	SMART
SPEC	1858	1958	1.53e-32	SMART
SPEC	1964	2065	6.23e-24	SMART
SPEC	2079	2179	2.08e-11	SMART
SPEC	2193	2315	3.27e0	SMART
EFh	2333	2361	5.78e-7	SMART
EFh	2376	2404	3.85e-3	SMART
efhand_Ca_insen	2408	2477	6.74e-32	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113741

SMART Domains

Protein: ENSMUSP00000109370
Gene: ENSMUSG00000057738

Domain	Start	End	E-Value	Type
Blast:SPEC	11	53	1e-20	BLAST
SPEC	59	136	3.03e-13	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000129241
AA Change: R295*

SMART Domains

Protein: ENSMUSP00000121116
Gene: ENSMUSG00000057738
AA Change: R295*

Domain	Start	End	E-Value	Type
Pfam:Spectrin	1	65	9.9e-10	PFAM
SPEC	78	178	2.08e-11	SMART
SPEC	192	314	3.27e0	SMART
EFh	332	360	5.78e-7	SMART
EFh	375	403	3.85e-3	SMART
efhand_Ca_insen	407	476	6.74e-32	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143918

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are a family of filamentous cytoskeletal proteins that function as essential scaffold proteins that stabilize the plasma membrane and organize intracellular organelles. Spectrins are composed of alpha and beta dimers that associate to form tetramers linked in a head-to-head arrangement. This gene encodes an alpha spectrin that is specifically expressed in nonerythrocytic cells. The encoded protein has been implicated in other cellular functions including DNA repair and cell cycle regulation. Mutations in this gene are the cause of early infantile epileptic encephalopathy-5. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous deletion of the exons encoding the CCC region are normal. Mice homozygous for a gene trap allele exhibit embryonic lethality and abnormal nervous system, heart and craniofacial morphology. [provided by MGI curators]

Allele List at MGI

All alleles(76) : Targeted(1) Gene trapped(75)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef28	A	T	13: 98,065,999 (GRCm39)	V1618D	probably benign	Het
Asic5	T	A	3: 81,911,791 (GRCm39)	F129Y	probably benign	Het
Cachd1	A	C	4: 100,831,276 (GRCm39)	K689N	probably damaging	Het
Cbfa2t2	A	G	2: 154,278,782 (GRCm39)		probably benign	Het
Cdh26	T	C	2: 178,108,482 (GRCm39)	V360A	probably damaging	Het
Col9a3	C	T	2: 180,261,525 (GRCm39)	A605V	probably benign	Het
Csn3	A	G	5: 88,077,910 (GRCm39)	T139A	probably benign	Het
Ddx27	G	T	2: 166,859,806 (GRCm39)	K79N	possibly damaging	Het
Dhx29	G	A	13: 113,069,749 (GRCm39)	D211N	probably benign	Het
Dlg2	A	G	7: 91,646,532 (GRCm39)		probably null	Het
Dse	C	A	10: 34,028,678 (GRCm39)	R804L	probably benign	Het
Fgb	T	C	3: 82,956,984 (GRCm39)		probably null	Het
Gm11011	A	T	2: 169,429,392 (GRCm39)	I31K	unknown	Het
Hira	A	G	16: 18,735,349 (GRCm39)	T272A	probably damaging	Het
Lcmt1	T	A	7: 123,000,686 (GRCm39)	H117Q	probably benign	Het
Mettl23	A	G	11: 116,734,437 (GRCm39)		probably benign	Het
Mtmr2	T	C	9: 13,704,463 (GRCm39)	Y197H	probably benign	Het
Myo9a	T	G	9: 59,778,284 (GRCm39)	S1347A	probably benign	Het
Myrfl	A	G	10: 116,658,661 (GRCm39)	V432A	probably damaging	Het
Npdc1	G	A	2: 25,298,957 (GRCm39)	D284N	probably damaging	Het
Obscn	G	T	11: 58,925,531 (GRCm39)	H6347Q	possibly damaging	Het
Or52r1b	A	T	7: 102,691,547 (GRCm39)	Y282F	probably damaging	Het
Or8b53	T	A	9: 38,667,000 (GRCm39)	N5K	probably damaging	Het
Peg10	A	G	6: 4,755,913 (GRCm39)		probably benign	Het
Pfkfb3	A	G	2: 11,506,483 (GRCm39)	V10A	probably benign	Het
Phf12	A	G	11: 77,915,871 (GRCm39)	D175G	probably damaging	Het
Plekhg6	T	G	6: 125,352,755 (GRCm39)	I131L	possibly damaging	Het
Ptbp3	A	G	4: 59,485,626 (GRCm39)	V95A	probably damaging	Het
Rbbp8	A	G	18: 11,855,664 (GRCm39)	T604A	probably benign	Het
Rbbp8nl	G	A	2: 179,921,586 (GRCm39)	P266L	possibly damaging	Het
Ryr1	T	C	7: 28,715,148 (GRCm39)	S4659G	unknown	Het
Serpinb9d	A	G	13: 33,380,423 (GRCm39)		probably null	Het
Slc22a28	A	C	19: 8,048,462 (GRCm39)	I395S	possibly damaging	Het
Slco6c1	T	A	1: 97,055,656 (GRCm39)	I82L	probably benign	Het
Tdrd9	C	T	12: 111,964,336 (GRCm39)		probably null	Het
Ube2v2	A	G	16: 15,374,343 (GRCm39)	L77P	possibly damaging	Het
Ugt3a1	T	C	15: 9,361,769 (GRCm39)	S182P	probably damaging	Het
Vwa5b1	T	C	4: 138,336,201 (GRCm39)	E131G	probably damaging	Het
Wdr18	C	T	10: 79,800,872 (GRCm39)	A145V	probably benign	Het
Xpnpep1	A	G	19: 52,993,253 (GRCm39)	I358T	probably damaging	Het
Zfp946	T	A	17: 22,673,676 (GRCm39)	C143*	probably null	Het

Other mutations in Sptan1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00668:Sptan1	APN	2	29,883,968 (GRCm39)	critical splice donor site	probably null
IGL00932:Sptan1	APN	2	29,905,622 (GRCm39)	missense	probably damaging	1.00
IGL00945:Sptan1	APN	2	29,890,083 (GRCm39)	splice site	probably benign
IGL01070:Sptan1	APN	2	29,904,185 (GRCm39)	critical splice donor site	probably null
IGL01625:Sptan1	APN	2	29,916,126 (GRCm39)	missense	probably damaging	1.00
IGL01657:Sptan1	APN	2	29,908,491 (GRCm39)	missense	probably benign	0.12
IGL01795:Sptan1	APN	2	29,908,501 (GRCm39)	missense	probably benign	0.07
IGL01982:Sptan1	APN	2	29,909,980 (GRCm39)	missense	probably damaging	1.00
IGL02040:Sptan1	APN	2	29,903,725 (GRCm39)	missense	probably benign	0.43
IGL02158:Sptan1	APN	2	29,920,336 (GRCm39)	missense	probably damaging	0.97
IGL02370:Sptan1	APN	2	29,920,752 (GRCm39)	missense	probably damaging	0.99
IGL02507:Sptan1	APN	2	29,906,067 (GRCm39)	missense	probably damaging	1.00
IGL02552:Sptan1	APN	2	29,908,486 (GRCm39)	missense	probably damaging	0.99
IGL02690:Sptan1	APN	2	29,888,195 (GRCm39)	missense	possibly damaging	0.78
IGL02715:Sptan1	APN	2	29,868,588 (GRCm39)	missense	probably benign	0.03
IGL02725:Sptan1	APN	2	29,886,055 (GRCm39)	missense	probably damaging	0.99
IGL03033:Sptan1	APN	2	29,881,045 (GRCm39)	missense	probably damaging	1.00
IGL03304:Sptan1	APN	2	29,876,505 (GRCm39)	missense	probably damaging	1.00
IGL03405:Sptan1	APN	2	29,915,593 (GRCm39)	missense	probably damaging	0.99
R0058:Sptan1	UTSW	2	29,883,708 (GRCm39)	splice site	probably null
R0058:Sptan1	UTSW	2	29,883,708 (GRCm39)	splice site	probably null
R0066:Sptan1	UTSW	2	29,893,679 (GRCm39)	splice site	probably benign
R0066:Sptan1	UTSW	2	29,893,679 (GRCm39)	splice site	probably benign
R0071:Sptan1	UTSW	2	29,893,354 (GRCm39)	nonsense	probably null
R0071:Sptan1	UTSW	2	29,893,354 (GRCm39)	nonsense	probably null
R0094:Sptan1	UTSW	2	29,896,635 (GRCm39)	missense	probably benign	0.37
R0230:Sptan1	UTSW	2	29,900,704 (GRCm39)	splice site	probably benign
R0242:Sptan1	UTSW	2	29,908,413 (GRCm39)	missense	probably benign	0.00
R0242:Sptan1	UTSW	2	29,908,413 (GRCm39)	missense	probably benign	0.00
R0366:Sptan1	UTSW	2	29,882,764 (GRCm39)	splice site	probably null
R0368:Sptan1	UTSW	2	29,883,927 (GRCm39)	missense	probably benign	0.29
R0396:Sptan1	UTSW	2	29,881,045 (GRCm39)	missense	probably damaging	1.00
R0423:Sptan1	UTSW	2	29,918,684 (GRCm39)	missense	probably null
R0448:Sptan1	UTSW	2	29,916,822 (GRCm39)	missense	probably damaging	1.00
R0485:Sptan1	UTSW	2	29,903,860 (GRCm39)	splice site	probably benign
R0580:Sptan1	UTSW	2	29,897,587 (GRCm39)	missense	probably damaging	0.99
R0739:Sptan1	UTSW	2	29,903,530 (GRCm39)	missense	probably damaging	1.00
R0924:Sptan1	UTSW	2	29,906,040 (GRCm39)	missense	probably damaging	0.98
R0930:Sptan1	UTSW	2	29,906,040 (GRCm39)	missense	probably damaging	0.98
R0961:Sptan1	UTSW	2	29,870,075 (GRCm39)	splice site	probably null
R1352:Sptan1	UTSW	2	29,911,199 (GRCm39)	splice site	probably benign
R1456:Sptan1	UTSW	2	29,870,215 (GRCm39)	critical splice donor site	probably null
R1537:Sptan1	UTSW	2	29,916,034 (GRCm39)	missense	possibly damaging	0.95
R1542:Sptan1	UTSW	2	29,917,139 (GRCm39)	missense	probably damaging	1.00
R1612:Sptan1	UTSW	2	29,893,348 (GRCm39)	missense	probably damaging	1.00
R1623:Sptan1	UTSW	2	29,876,432 (GRCm39)	missense	probably damaging	0.96
R1834:Sptan1	UTSW	2	29,882,013 (GRCm39)	splice site	probably benign
R1879:Sptan1	UTSW	2	29,885,540 (GRCm39)	missense	probably damaging	1.00
R1893:Sptan1	UTSW	2	29,910,472 (GRCm39)	missense	probably damaging	0.98
R1914:Sptan1	UTSW	2	29,901,048 (GRCm39)	missense	probably benign	0.00
R1915:Sptan1	UTSW	2	29,901,048 (GRCm39)	missense	probably benign	0.00
R2022:Sptan1	UTSW	2	29,897,573 (GRCm39)	missense	probably damaging	0.96
R2050:Sptan1	UTSW	2	29,892,250 (GRCm39)	missense	probably benign
R2103:Sptan1	UTSW	2	29,920,483 (GRCm39)	missense	probably damaging	1.00
R2162:Sptan1	UTSW	2	29,908,588 (GRCm39)	splice site	probably benign
R2931:Sptan1	UTSW	2	29,908,500 (GRCm39)	missense	probably benign
R3726:Sptan1	UTSW	2	29,908,431 (GRCm39)	missense	possibly damaging	0.59
R4170:Sptan1	UTSW	2	29,920,037 (GRCm39)	missense	possibly damaging	0.93
R4235:Sptan1	UTSW	2	29,916,600 (GRCm39)	missense	probably damaging	1.00
R4378:Sptan1	UTSW	2	29,915,581 (GRCm39)	missense	probably damaging	1.00
R4424:Sptan1	UTSW	2	29,919,721 (GRCm39)	intron	probably benign
R4718:Sptan1	UTSW	2	29,921,074 (GRCm39)	missense	probably damaging	1.00
R4777:Sptan1	UTSW	2	29,886,447 (GRCm39)	missense	probably damaging	0.98
R4849:Sptan1	UTSW	2	29,901,054 (GRCm39)	missense	probably damaging	1.00
R5158:Sptan1	UTSW	2	29,868,455 (GRCm39)	missense	probably damaging	1.00
R5180:Sptan1	UTSW	2	29,883,736 (GRCm39)	intron	probably benign
R5181:Sptan1	UTSW	2	29,883,736 (GRCm39)	intron	probably benign
R5383:Sptan1	UTSW	2	29,901,340 (GRCm39)	missense	probably damaging	1.00
R5592:Sptan1	UTSW	2	29,876,731 (GRCm39)	intron	probably benign
R5639:Sptan1	UTSW	2	29,881,005 (GRCm39)	nonsense	probably null
R5801:Sptan1	UTSW	2	29,920,613 (GRCm39)	splice site	probably null
R5947:Sptan1	UTSW	2	29,884,379 (GRCm39)	critical splice donor site	probably null
R6056:Sptan1	UTSW	2	29,886,794 (GRCm39)	missense	probably benign	0.36
R6090:Sptan1	UTSW	2	29,883,899 (GRCm39)	missense	probably damaging	1.00
R6146:Sptan1	UTSW	2	29,894,535 (GRCm39)	missense	probably benign	0.01
R6254:Sptan1	UTSW	2	29,897,561 (GRCm39)	missense	possibly damaging	0.93
R6366:Sptan1	UTSW	2	29,910,467 (GRCm39)	missense	possibly damaging	0.47
R6378:Sptan1	UTSW	2	29,908,527 (GRCm39)	missense	probably damaging	1.00
R6521:Sptan1	UTSW	2	29,910,467 (GRCm39)	missense	possibly damaging	0.47
R6877:Sptan1	UTSW	2	29,920,985 (GRCm39)	missense	probably damaging	0.99
R7173:Sptan1	UTSW	2	29,873,221 (GRCm39)	missense	probably benign	0.02
R7248:Sptan1	UTSW	2	29,892,311 (GRCm39)	missense	probably benign	0.10
R7282:Sptan1	UTSW	2	29,876,941 (GRCm39)	missense	probably damaging	1.00
R7527:Sptan1	UTSW	2	29,870,209 (GRCm39)	missense	probably damaging	1.00
R7585:Sptan1	UTSW	2	29,890,068 (GRCm39)	missense	probably benign	0.06
R7779:Sptan1	UTSW	2	29,911,319 (GRCm39)	missense	probably damaging	1.00
R8051:Sptan1	UTSW	2	29,920,171 (GRCm39)	missense	probably damaging	1.00
R8055:Sptan1	UTSW	2	29,884,351 (GRCm39)	missense	probably benign	0.22
R8103:Sptan1	UTSW	2	29,910,055 (GRCm39)	missense	probably damaging	1.00
R8283:Sptan1	UTSW	2	29,870,212 (GRCm39)	missense	probably damaging	1.00
R8507:Sptan1	UTSW	2	29,916,596 (GRCm39)	missense	probably damaging	1.00
R8963:Sptan1	UTSW	2	29,873,744 (GRCm39)	missense	possibly damaging	0.92
R9126:Sptan1	UTSW	2	29,920,597 (GRCm39)	missense	probably damaging	0.99
R9206:Sptan1	UTSW	2	29,920,724 (GRCm39)	missense	possibly damaging	0.90
R9273:Sptan1	UTSW	2	29,880,977 (GRCm39)	missense	possibly damaging	0.88
X0028:Sptan1	UTSW	2	29,910,042 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGCAGAGCTCGGACTCTG -3'
(R):5'- GTGGCTAACTAACATAATCAGTGG -3'

Sequencing Primer
(F):5'- CAGAGCTCGGACTCTGGTGTTC -3'
(R):5'- CACCTTTAATCCCAGTACTTGAGAGG -3'

Posted On

2016-10-24