Incidental Mutation 'R5573:Rbbp8nl'
ID435766
Institutional Source Beutler Lab
Gene Symbol Rbbp8nl
Ensembl Gene ENSMUSG00000038980
Gene NameRBBP8 N-terminal like
Synonyms
MMRRC Submission 043128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5573 (G1)
Quality Score220
Status Not validated
Chromosome2
Chromosomal Location180277646-180289879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 180279793 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 266 (P266L)
Ref Sequence ENSEMBL: ENSMUSP00000047237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038529]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038529
AA Change: P266L

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047237
Gene: ENSMUSG00000038980
AA Change: P266L

DomainStartEndE-ValueType
Pfam:CtIP_N 4 123 5.6e-56 PFAM
low complexity region 143 154 N/A INTRINSIC
low complexity region 157 172 N/A INTRINSIC
low complexity region 237 250 N/A INTRINSIC
low complexity region 282 296 N/A INTRINSIC
low complexity region 352 361 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 585 590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 A T 13: 97,929,491 V1618D probably benign Het
Asic5 T A 3: 82,004,484 F129Y probably benign Het
Cachd1 A C 4: 100,974,079 K689N probably damaging Het
Cbfa2t2 A G 2: 154,436,862 probably benign Het
Cdh26 T C 2: 178,466,689 V360A probably damaging Het
Col9a3 C T 2: 180,619,732 A605V probably benign Het
Csn3 A G 5: 87,930,051 T139A probably benign Het
Ddx27 G T 2: 167,017,886 K79N possibly damaging Het
Dhx29 G A 13: 112,933,215 D211N probably benign Het
Dlg2 A G 7: 91,997,324 probably null Het
Dse C A 10: 34,152,682 R804L probably benign Het
Fgb T C 3: 83,049,677 probably null Het
Gm11011 A T 2: 169,587,472 I31K unknown Het
Hira A G 16: 18,916,599 T272A probably damaging Het
Lcmt1 T A 7: 123,401,463 H117Q probably benign Het
Mettl23 A G 11: 116,843,611 probably benign Het
Mtmr2 T C 9: 13,793,167 Y197H probably benign Het
Myo9a T G 9: 59,871,001 S1347A probably benign Het
Myrfl A G 10: 116,822,756 V432A probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obscn G T 11: 59,034,705 H6347Q possibly damaging Het
Olfr582 A T 7: 103,042,340 Y282F probably damaging Het
Olfr920 T A 9: 38,755,704 N5K probably damaging Het
Peg10 A G 6: 4,755,913 probably benign Het
Pfkfb3 A G 2: 11,501,672 V10A probably benign Het
Phf12 A G 11: 78,025,045 D175G probably damaging Het
Plekhg6 T G 6: 125,375,792 I131L possibly damaging Het
Ptbp3 A G 4: 59,485,626 V95A probably damaging Het
Rbbp8 A G 18: 11,722,607 T604A probably benign Het
Ryr1 T C 7: 29,015,723 S4659G unknown Het
Serpinb9d A G 13: 33,196,440 probably null Het
Slc22a28 A C 19: 8,071,097 I395S possibly damaging Het
Slco6c1 T A 1: 97,127,931 I82L probably benign Het
Sptan1 C T 2: 29,986,492 R295* probably null Het
Tdrd9 C T 12: 111,997,902 probably null Het
Ube2v2 A G 16: 15,556,479 L77P possibly damaging Het
Ugt3a2 T C 15: 9,361,683 S182P probably damaging Het
Vwa5b1 T C 4: 138,608,890 E131G probably damaging Het
Wdr18 C T 10: 79,965,038 A145V probably benign Het
Xpnpep1 A G 19: 53,004,822 I358T probably damaging Het
Zfp946 T A 17: 22,454,695 C143* probably null Het
Other mutations in Rbbp8nl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01802:Rbbp8nl APN 2 180279695 missense probably benign 0.01
IGL01845:Rbbp8nl APN 2 180283311 missense probably damaging 0.99
IGL01966:Rbbp8nl APN 2 180280989 splice site probably benign
IGL02217:Rbbp8nl APN 2 180278188 unclassified probably benign
IGL02500:Rbbp8nl APN 2 180279329 missense possibly damaging 0.57
IGL02623:Rbbp8nl APN 2 180281443 missense probably damaging 0.99
IGL02634:Rbbp8nl APN 2 180280895 missense probably benign 0.00
F5770:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
R0380:Rbbp8nl UTSW 2 180281719 missense probably damaging 0.96
R1773:Rbbp8nl UTSW 2 180281194 missense probably benign 0.00
R1858:Rbbp8nl UTSW 2 180282213 splice site probably benign
R1901:Rbbp8nl UTSW 2 180283313 missense probably damaging 1.00
R1962:Rbbp8nl UTSW 2 180280874 missense probably benign 0.03
R2423:Rbbp8nl UTSW 2 180280971 missense probably damaging 0.98
R2495:Rbbp8nl UTSW 2 180279102 missense probably null 0.31
R3738:Rbbp8nl UTSW 2 180281248 missense probably benign 0.37
R4460:Rbbp8nl UTSW 2 180280971 missense probably benign 0.41
R4502:Rbbp8nl UTSW 2 180279196 missense possibly damaging 0.48
R5699:Rbbp8nl UTSW 2 180278668 missense probably damaging 0.98
R6242:Rbbp8nl UTSW 2 180280974 missense probably damaging 1.00
R6269:Rbbp8nl UTSW 2 180281512 nonsense probably null
R6586:Rbbp8nl UTSW 2 180280959 missense probably damaging 1.00
R6875:Rbbp8nl UTSW 2 180279226 missense probably benign 0.00
V7581:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
V7582:Rbbp8nl UTSW 2 180278208 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAAGCAGGTGTAATGCCCCTTC -3'
(R):5'- AGCCATGTGATGTCAGGTGG -3'

Sequencing Primer
(F):5'- GTAATGCCCCTTCCAGCCG -3'
(R):5'- AGGTGGCTTGCCTGACCTTC -3'
Posted On2016-10-24