Incidental Mutation 'R5573:Col9a3'
ID435767
Institutional Source Beutler Lab
Gene Symbol Col9a3
Ensembl Gene ENSMUSG00000027570
Gene Namecollagen, type IX, alpha 3
Synonyms
MMRRC Submission 043128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.229) question?
Stock #R5573 (G1)
Quality Score214
Status Not validated
Chromosome2
Chromosomal Location180597790-180622189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 180619732 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 605 (A605V)
Ref Sequence ENSEMBL: ENSMUSP00000128718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037877] [ENSMUST00000103059] [ENSMUST00000132527]
Predicted Effect probably benign
Transcript: ENSMUST00000037877
SMART Domains Protein: ENSMUSP00000040611
Gene: ENSMUSG00000038932

DomainStartEndE-ValueType
low complexity region 3 36 N/A INTRINSIC
low complexity region 76 110 N/A INTRINSIC
low complexity region 152 167 N/A INTRINSIC
low complexity region 185 198 N/A INTRINSIC
low complexity region 355 373 N/A INTRINSIC
HLH 395 445 2.13e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103059
AA Change: A605V

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570
AA Change: A605V

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132527
AA Change: A605V

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570
AA Change: A605V

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165879
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 A T 13: 97,929,491 V1618D probably benign Het
Asic5 T A 3: 82,004,484 F129Y probably benign Het
Cachd1 A C 4: 100,974,079 K689N probably damaging Het
Cbfa2t2 A G 2: 154,436,862 probably benign Het
Cdh26 T C 2: 178,466,689 V360A probably damaging Het
Csn3 A G 5: 87,930,051 T139A probably benign Het
Ddx27 G T 2: 167,017,886 K79N possibly damaging Het
Dhx29 G A 13: 112,933,215 D211N probably benign Het
Dlg2 A G 7: 91,997,324 probably null Het
Dse C A 10: 34,152,682 R804L probably benign Het
Fgb T C 3: 83,049,677 probably null Het
Gm11011 A T 2: 169,587,472 I31K unknown Het
Hira A G 16: 18,916,599 T272A probably damaging Het
Lcmt1 T A 7: 123,401,463 H117Q probably benign Het
Mettl23 A G 11: 116,843,611 probably benign Het
Mtmr2 T C 9: 13,793,167 Y197H probably benign Het
Myo9a T G 9: 59,871,001 S1347A probably benign Het
Myrfl A G 10: 116,822,756 V432A probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obscn G T 11: 59,034,705 H6347Q possibly damaging Het
Olfr582 A T 7: 103,042,340 Y282F probably damaging Het
Olfr920 T A 9: 38,755,704 N5K probably damaging Het
Peg10 A G 6: 4,755,913 probably benign Het
Pfkfb3 A G 2: 11,501,672 V10A probably benign Het
Phf12 A G 11: 78,025,045 D175G probably damaging Het
Plekhg6 T G 6: 125,375,792 I131L possibly damaging Het
Ptbp3 A G 4: 59,485,626 V95A probably damaging Het
Rbbp8 A G 18: 11,722,607 T604A probably benign Het
Rbbp8nl G A 2: 180,279,793 P266L possibly damaging Het
Ryr1 T C 7: 29,015,723 S4659G unknown Het
Serpinb9d A G 13: 33,196,440 probably null Het
Slc22a28 A C 19: 8,071,097 I395S possibly damaging Het
Slco6c1 T A 1: 97,127,931 I82L probably benign Het
Sptan1 C T 2: 29,986,492 R295* probably null Het
Tdrd9 C T 12: 111,997,902 probably null Het
Ube2v2 A G 16: 15,556,479 L77P possibly damaging Het
Ugt3a2 T C 15: 9,361,683 S182P probably damaging Het
Vwa5b1 T C 4: 138,608,890 E131G probably damaging Het
Wdr18 C T 10: 79,965,038 A145V probably benign Het
Xpnpep1 A G 19: 53,004,822 I358T probably damaging Het
Zfp946 T A 17: 22,454,695 C143* probably null Het
Other mutations in Col9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Col9a3 APN 2 180616434 missense probably damaging 0.96
IGL01542:Col9a3 APN 2 180609316 splice site probably benign
IGL01727:Col9a3 APN 2 180616565 critical splice donor site probably null
IGL02558:Col9a3 APN 2 180606806 critical splice acceptor site probably null
IGL03112:Col9a3 APN 2 180607642 missense possibly damaging 0.60
IGL02796:Col9a3 UTSW 2 180614162 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0477:Col9a3 UTSW 2 180609470 splice site probably benign
R0890:Col9a3 UTSW 2 180610063 missense probably benign 0.23
R1934:Col9a3 UTSW 2 180607134 missense probably damaging 0.98
R4355:Col9a3 UTSW 2 180606478 missense probably benign 0.00
R4571:Col9a3 UTSW 2 180616366 splice site probably benign
R4688:Col9a3 UTSW 2 180607631 missense probably damaging 0.99
R4731:Col9a3 UTSW 2 180610681 missense probably damaging 0.99
R4742:Col9a3 UTSW 2 180603387 missense unknown
R4847:Col9a3 UTSW 2 180615525 missense probably damaging 1.00
R4985:Col9a3 UTSW 2 180603400 missense unknown
R5488:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5489:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5575:Col9a3 UTSW 2 180598846 intron probably benign
R6820:Col9a3 UTSW 2 180607134 missense probably damaging 0.98
R7114:Col9a3 UTSW 2 180603797 missense unknown
R7710:Col9a3 UTSW 2 180609365 missense probably damaging 0.98
R8177:Col9a3 UTSW 2 180607657 missense probably damaging 0.97
R8342:Col9a3 UTSW 2 180603390 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCAGACTTCCACAAAGCTGC -3'
(R):5'- GAACAGGCGGTATATTTAGTAGGATAC -3'

Sequencing Primer
(F):5'- TGCACTTTGGTGAACAGCC -3'
(R):5'- ACCTACTTAGCTAAAGTTAGGTACAG -3'
Posted On2016-10-24