Incidental Mutation 'R5573:Csn3'
ID435773
Institutional Source Beutler Lab
Gene Symbol Csn3
Ensembl Gene ENSMUSG00000001622
Gene Namecasein kappa
SynonymsCSN10, Csnk
MMRRC Submission 043128-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5573 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location87925579-87932665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87930051 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 139 (T139A)
Ref Sequence ENSEMBL: ENSMUSP00000108896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001667] [ENSMUST00000113267] [ENSMUST00000113271]
Predicted Effect probably benign
Transcript: ENSMUST00000001667
AA Change: T139A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001667
Gene: ENSMUSG00000001622
AA Change: T139A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Casein_kappa 22 180 2.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113267
AA Change: T139A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108892
Gene: ENSMUSG00000001622
AA Change: T139A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Casein_kappa 22 181 2.7e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113271
AA Change: T139A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108896
Gene: ENSMUSG00000001622
AA Change: T139A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Casein_kappa 22 181 2.7e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190123
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display lactation failure and abnormal milk composition, but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 A T 13: 97,929,491 V1618D probably benign Het
Asic5 T A 3: 82,004,484 F129Y probably benign Het
Cachd1 A C 4: 100,974,079 K689N probably damaging Het
Cbfa2t2 A G 2: 154,436,862 probably benign Het
Cdh26 T C 2: 178,466,689 V360A probably damaging Het
Col9a3 C T 2: 180,619,732 A605V probably benign Het
Ddx27 G T 2: 167,017,886 K79N possibly damaging Het
Dhx29 G A 13: 112,933,215 D211N probably benign Het
Dlg2 A G 7: 91,997,324 probably null Het
Dse C A 10: 34,152,682 R804L probably benign Het
Fgb T C 3: 83,049,677 probably null Het
Gm11011 A T 2: 169,587,472 I31K unknown Het
Hira A G 16: 18,916,599 T272A probably damaging Het
Lcmt1 T A 7: 123,401,463 H117Q probably benign Het
Mettl23 A G 11: 116,843,611 probably benign Het
Mtmr2 T C 9: 13,793,167 Y197H probably benign Het
Myo9a T G 9: 59,871,001 S1347A probably benign Het
Myrfl A G 10: 116,822,756 V432A probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obscn G T 11: 59,034,705 H6347Q possibly damaging Het
Olfr582 A T 7: 103,042,340 Y282F probably damaging Het
Olfr920 T A 9: 38,755,704 N5K probably damaging Het
Peg10 A G 6: 4,755,913 probably benign Het
Pfkfb3 A G 2: 11,501,672 V10A probably benign Het
Phf12 A G 11: 78,025,045 D175G probably damaging Het
Plekhg6 T G 6: 125,375,792 I131L possibly damaging Het
Ptbp3 A G 4: 59,485,626 V95A probably damaging Het
Rbbp8 A G 18: 11,722,607 T604A probably benign Het
Rbbp8nl G A 2: 180,279,793 P266L possibly damaging Het
Ryr1 T C 7: 29,015,723 S4659G unknown Het
Serpinb9d A G 13: 33,196,440 probably null Het
Slc22a28 A C 19: 8,071,097 I395S possibly damaging Het
Slco6c1 T A 1: 97,127,931 I82L probably benign Het
Sptan1 C T 2: 29,986,492 R295* probably null Het
Tdrd9 C T 12: 111,997,902 probably null Het
Ube2v2 A G 16: 15,556,479 L77P possibly damaging Het
Ugt3a2 T C 15: 9,361,683 S182P probably damaging Het
Vwa5b1 T C 4: 138,608,890 E131G probably damaging Het
Wdr18 C T 10: 79,965,038 A145V probably benign Het
Xpnpep1 A G 19: 53,004,822 I358T probably damaging Het
Zfp946 T A 17: 22,454,695 C143* probably null Het
Other mutations in Csn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Csn3 APN 5 87930157 missense unknown
IGL02153:Csn3 APN 5 87930097 missense possibly damaging 0.80
IGL02936:Csn3 APN 5 87930133 missense possibly damaging 0.93
R0617:Csn3 UTSW 5 87929871 missense probably benign 0.18
R1502:Csn3 UTSW 5 87930124 missense probably damaging 0.98
R2329:Csn3 UTSW 5 87930003 missense possibly damaging 0.95
R3710:Csn3 UTSW 5 87930023 missense possibly damaging 0.63
R4514:Csn3 UTSW 5 87930138 missense unknown
R5079:Csn3 UTSW 5 87929767 missense possibly damaging 0.92
R5233:Csn3 UTSW 5 87929835 missense probably benign 0.13
R5913:Csn3 UTSW 5 87927611 missense probably damaging 0.99
R7175:Csn3 UTSW 5 87929727 missense probably damaging 0.98
R7577:Csn3 UTSW 5 87929962 missense not run
Predicted Primers PCR Primer
(F):5'- TGCTACTGCTAGCCCATACA -3'
(R):5'- ATTGTGTGAATTTGTCCATGCTT -3'

Sequencing Primer
(F):5'- GCTACTGCTAGCCCATACATGTAC -3'
(R):5'- GAATTTGTCCATGCTTTTTACCCAG -3'
Posted On2016-10-24