Incidental Mutation 'R5573:Olfr920'
ID435781
Institutional Source Beutler Lab
Gene Symbol Olfr920
Ensembl Gene ENSMUSG00000061039
Gene Nameolfactory receptor 920
SynonymsMOR165-6, GA_x6K02T2PVTD-32458442-32459374
MMRRC Submission 043128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R5573 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location38752299-38760117 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38755704 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 5 (N5K)
Ref Sequence ENSEMBL: ENSMUSP00000074300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074740]
Predicted Effect probably damaging
Transcript: ENSMUST00000074740
AA Change: N5K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074300
Gene: ENSMUSG00000061039
AA Change: N5K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.2e-47 PFAM
Pfam:7tm_1 41 290 3.6e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 A T 13: 97,929,491 V1618D probably benign Het
Asic5 T A 3: 82,004,484 F129Y probably benign Het
Cachd1 A C 4: 100,974,079 K689N probably damaging Het
Cbfa2t2 A G 2: 154,436,862 probably benign Het
Cdh26 T C 2: 178,466,689 V360A probably damaging Het
Col9a3 C T 2: 180,619,732 A605V probably benign Het
Csn3 A G 5: 87,930,051 T139A probably benign Het
Ddx27 G T 2: 167,017,886 K79N possibly damaging Het
Dhx29 G A 13: 112,933,215 D211N probably benign Het
Dlg2 A G 7: 91,997,324 probably null Het
Dse C A 10: 34,152,682 R804L probably benign Het
Fgb T C 3: 83,049,677 probably null Het
Gm11011 A T 2: 169,587,472 I31K unknown Het
Hira A G 16: 18,916,599 T272A probably damaging Het
Lcmt1 T A 7: 123,401,463 H117Q probably benign Het
Mettl23 A G 11: 116,843,611 probably benign Het
Mtmr2 T C 9: 13,793,167 Y197H probably benign Het
Myo9a T G 9: 59,871,001 S1347A probably benign Het
Myrfl A G 10: 116,822,756 V432A probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obscn G T 11: 59,034,705 H6347Q possibly damaging Het
Olfr582 A T 7: 103,042,340 Y282F probably damaging Het
Peg10 A G 6: 4,755,913 probably benign Het
Pfkfb3 A G 2: 11,501,672 V10A probably benign Het
Phf12 A G 11: 78,025,045 D175G probably damaging Het
Plekhg6 T G 6: 125,375,792 I131L possibly damaging Het
Ptbp3 A G 4: 59,485,626 V95A probably damaging Het
Rbbp8 A G 18: 11,722,607 T604A probably benign Het
Rbbp8nl G A 2: 180,279,793 P266L possibly damaging Het
Ryr1 T C 7: 29,015,723 S4659G unknown Het
Serpinb9d A G 13: 33,196,440 probably null Het
Slc22a28 A C 19: 8,071,097 I395S possibly damaging Het
Slco6c1 T A 1: 97,127,931 I82L probably benign Het
Sptan1 C T 2: 29,986,492 R295* probably null Het
Tdrd9 C T 12: 111,997,902 probably null Het
Ube2v2 A G 16: 15,556,479 L77P possibly damaging Het
Ugt3a2 T C 15: 9,361,683 S182P probably damaging Het
Vwa5b1 T C 4: 138,608,890 E131G probably damaging Het
Wdr18 C T 10: 79,965,038 A145V probably benign Het
Xpnpep1 A G 19: 53,004,822 I358T probably damaging Het
Zfp946 T A 17: 22,454,695 C143* probably null Het
Other mutations in Olfr920
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01686:Olfr920 APN 9 38756254 missense probably damaging 1.00
IGL01728:Olfr920 APN 9 38756095 missense possibly damaging 0.63
IGL01867:Olfr920 APN 9 38755898 missense probably damaging 1.00
IGL02271:Olfr920 APN 9 38756488 missense probably benign
IGL03078:Olfr920 APN 9 38756245 nonsense probably null
R0166:Olfr920 UTSW 9 38756188 missense probably benign
R0446:Olfr920 UTSW 9 38755818 missense probably damaging 1.00
R0453:Olfr920 UTSW 9 38756129 missense probably damaging 0.99
R0556:Olfr920 UTSW 9 38755745 missense possibly damaging 0.88
R1585:Olfr920 UTSW 9 38756420 missense probably damaging 1.00
R2847:Olfr920 UTSW 9 38756036 missense possibly damaging 0.89
R4676:Olfr920 UTSW 9 38755659 start gained probably benign
R4825:Olfr920 UTSW 9 38756407 missense probably damaging 1.00
R5026:Olfr920 UTSW 9 38755745 missense probably benign 0.01
R5144:Olfr920 UTSW 9 38756393 missense possibly damaging 0.90
R5872:Olfr920 UTSW 9 38756116 missense probably benign 0.06
R6131:Olfr920 UTSW 9 38756066 missense probably damaging 1.00
R6729:Olfr920 UTSW 9 38755828 missense probably benign 0.00
R7731:Olfr920 UTSW 9 38756246 missense possibly damaging 0.90
R7800:Olfr920 UTSW 9 38756618 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTTTCTACTTGTGTCACAGAGATG -3'
(R):5'- TGAGTCATACAACCCACATAGGAG -3'

Sequencing Primer
(F):5'- ACTTGTGTCACAGAGATGATAAAAC -3'
(R):5'- TTACAGAAGAGTAACAAAAGTCCAC -3'
Posted On2016-10-24