Incidental Mutation 'R5573:Slc22a28'
ID435801
Institutional Source Beutler Lab
Gene Symbol Slc22a28
Ensembl Gene ENSMUSG00000063590
Gene Namesolute carrier family 22, member 28
SynonymsGm5631
MMRRC Submission 043128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R5573 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8062209-8131982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 8071097 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 395 (I395S)
Ref Sequence ENSEMBL: ENSMUSP00000067114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065651]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065651
AA Change: I395S

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067114
Gene: ENSMUSG00000063590
AA Change: I395S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 1.4e-26 PFAM
Pfam:MFS_1 140 375 1.1e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 A T 13: 97,929,491 V1618D probably benign Het
Asic5 T A 3: 82,004,484 F129Y probably benign Het
Cachd1 A C 4: 100,974,079 K689N probably damaging Het
Cbfa2t2 A G 2: 154,436,862 probably benign Het
Cdh26 T C 2: 178,466,689 V360A probably damaging Het
Col9a3 C T 2: 180,619,732 A605V probably benign Het
Csn3 A G 5: 87,930,051 T139A probably benign Het
Ddx27 G T 2: 167,017,886 K79N possibly damaging Het
Dhx29 G A 13: 112,933,215 D211N probably benign Het
Dlg2 A G 7: 91,997,324 probably null Het
Dse C A 10: 34,152,682 R804L probably benign Het
Fgb T C 3: 83,049,677 probably null Het
Gm11011 A T 2: 169,587,472 I31K unknown Het
Hira A G 16: 18,916,599 T272A probably damaging Het
Lcmt1 T A 7: 123,401,463 H117Q probably benign Het
Mettl23 A G 11: 116,843,611 probably benign Het
Mtmr2 T C 9: 13,793,167 Y197H probably benign Het
Myo9a T G 9: 59,871,001 S1347A probably benign Het
Myrfl A G 10: 116,822,756 V432A probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obscn G T 11: 59,034,705 H6347Q possibly damaging Het
Olfr582 A T 7: 103,042,340 Y282F probably damaging Het
Olfr920 T A 9: 38,755,704 N5K probably damaging Het
Peg10 A G 6: 4,755,913 probably benign Het
Pfkfb3 A G 2: 11,501,672 V10A probably benign Het
Phf12 A G 11: 78,025,045 D175G probably damaging Het
Plekhg6 T G 6: 125,375,792 I131L possibly damaging Het
Ptbp3 A G 4: 59,485,626 V95A probably damaging Het
Rbbp8 A G 18: 11,722,607 T604A probably benign Het
Rbbp8nl G A 2: 180,279,793 P266L possibly damaging Het
Ryr1 T C 7: 29,015,723 S4659G unknown Het
Serpinb9d A G 13: 33,196,440 probably null Het
Slco6c1 T A 1: 97,127,931 I82L probably benign Het
Sptan1 C T 2: 29,986,492 R295* probably null Het
Tdrd9 C T 12: 111,997,902 probably null Het
Ube2v2 A G 16: 15,556,479 L77P possibly damaging Het
Ugt3a2 T C 15: 9,361,683 S182P probably damaging Het
Vwa5b1 T C 4: 138,608,890 E131G probably damaging Het
Wdr18 C T 10: 79,965,038 A145V probably benign Het
Xpnpep1 A G 19: 53,004,822 I358T probably damaging Het
Zfp946 T A 17: 22,454,695 C143* probably null Het
Other mutations in Slc22a28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a28 APN 19 8130203 missense possibly damaging 0.89
IGL00515:Slc22a28 APN 19 8117064 missense probably benign 0.34
IGL01025:Slc22a28 APN 19 8116908 splice site probably benign
IGL02697:Slc22a28 APN 19 8117127 missense probably benign 0.06
PIT4378001:Slc22a28 UTSW 19 8071914 missense probably damaging 0.96
R0744:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R0836:Slc22a28 UTSW 19 8116833 missense possibly damaging 0.94
R1398:Slc22a28 UTSW 19 8130202 nonsense probably null
R1456:Slc22a28 UTSW 19 8071858 missense possibly damaging 0.50
R1603:Slc22a28 UTSW 19 8063309 missense probably damaging 1.00
R1993:Slc22a28 UTSW 19 8117124 missense possibly damaging 0.79
R2254:Slc22a28 UTSW 19 8064493 missense probably benign
R2262:Slc22a28 UTSW 19 8071208 missense probably benign 0.00
R4078:Slc22a28 UTSW 19 8101413 missense probably benign 0.15
R4165:Slc22a28 UTSW 19 8063408 missense possibly damaging 0.95
R4612:Slc22a28 UTSW 19 8101406 missense probably damaging 1.00
R4947:Slc22a28 UTSW 19 8131452 missense probably benign 0.03
R5611:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
R5621:Slc22a28 UTSW 19 8071011 missense probably benign 0.00
R5671:Slc22a28 UTSW 19 8131431 missense probably damaging 1.00
R6063:Slc22a28 UTSW 19 8117022 missense probably benign 0.01
R6358:Slc22a28 UTSW 19 8071888 missense probably damaging 0.99
R6385:Slc22a28 UTSW 19 8101480 missense probably damaging 0.99
R6680:Slc22a28 UTSW 19 8101393 missense probably benign 0.07
R6767:Slc22a28 UTSW 19 8117045 missense probably damaging 1.00
R6865:Slc22a28 UTSW 19 8064491 nonsense probably null
R6947:Slc22a28 UTSW 19 8064510 missense possibly damaging 0.58
R7049:Slc22a28 UTSW 19 8071905 missense probably benign
R7269:Slc22a28 UTSW 19 8117127 missense probably benign 0.06
R7484:Slc22a28 UTSW 19 8071127 missense probably benign
R7823:Slc22a28 UTSW 19 8064525 missense probably benign 0.38
R7856:Slc22a28 UTSW 19 8063333 missense probably damaging 1.00
Z1088:Slc22a28 UTSW 19 8062398 missense probably damaging 0.96
Z1176:Slc22a28 UTSW 19 8062383 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTTTCCAGCATGGCAACC -3'
(R):5'- CGATGTGATCACTCATTACACAATG -3'

Sequencing Primer
(F):5'- CCAGCATGGCAACCAGAAATTATTTG -3'
(R):5'- TCATTACACAATGATTCTTGGTAGC -3'
Posted On2016-10-24