Incidental Mutation 'R5573:Xpnpep1'
ID435802
Institutional Source Beutler Lab
Gene Symbol Xpnpep1
Ensembl Gene ENSMUSG00000025027
Gene NameX-prolyl aminopeptidase (aminopeptidase P) 1, soluble
SynonymsD230045I08Rik
MMRRC Submission 043128-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5573 (G1)
Quality Score196
Status Not validated
Chromosome19
Chromosomal Location52943417-53040214 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53004822 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 358 (I358T)
Ref Sequence ENSEMBL: ENSMUSP00000138250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000182500] [ENSMUST00000183108] [ENSMUST00000183274]
Predicted Effect probably benign
Transcript: ENSMUST00000182500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182877
Predicted Effect probably damaging
Transcript: ENSMUST00000183108
AA Change: I358T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138250
Gene: ENSMUSG00000025027
AA Change: I358T

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 5.5e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183188
Predicted Effect probably damaging
Transcript: ENSMUST00000183274
AA Change: I358T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138233
Gene: ENSMUSG00000025027
AA Change: I358T

DomainStartEndE-ValueType
Pfam:Creatinase_N 53 198 1.2e-17 PFAM
Pfam:Peptidase_M24 371 587 1.9e-48 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cytosolic form of a metalloaminopeptidase that catalyzes the cleavage of the N-terminal amino acid adjacent to a proline residue. The gene product may play a role in degradation and maturation of tachykinins, neuropeptides, and peptide hormones. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit pre and postnatal lethality, reduced male survival, growth retardation with decreased body weight, size and length, microcephaly and peptiduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef28 A T 13: 97,929,491 V1618D probably benign Het
Asic5 T A 3: 82,004,484 F129Y probably benign Het
Cachd1 A C 4: 100,974,079 K689N probably damaging Het
Cbfa2t2 A G 2: 154,436,862 probably benign Het
Cdh26 T C 2: 178,466,689 V360A probably damaging Het
Col9a3 C T 2: 180,619,732 A605V probably benign Het
Csn3 A G 5: 87,930,051 T139A probably benign Het
Ddx27 G T 2: 167,017,886 K79N possibly damaging Het
Dhx29 G A 13: 112,933,215 D211N probably benign Het
Dlg2 A G 7: 91,997,324 probably null Het
Dse C A 10: 34,152,682 R804L probably benign Het
Fgb T C 3: 83,049,677 probably null Het
Gm11011 A T 2: 169,587,472 I31K unknown Het
Hira A G 16: 18,916,599 T272A probably damaging Het
Lcmt1 T A 7: 123,401,463 H117Q probably benign Het
Mettl23 A G 11: 116,843,611 probably benign Het
Mtmr2 T C 9: 13,793,167 Y197H probably benign Het
Myo9a T G 9: 59,871,001 S1347A probably benign Het
Myrfl A G 10: 116,822,756 V432A probably damaging Het
Npdc1 G A 2: 25,408,945 D284N probably damaging Het
Obscn G T 11: 59,034,705 H6347Q possibly damaging Het
Olfr582 A T 7: 103,042,340 Y282F probably damaging Het
Olfr920 T A 9: 38,755,704 N5K probably damaging Het
Peg10 A G 6: 4,755,913 probably benign Het
Pfkfb3 A G 2: 11,501,672 V10A probably benign Het
Phf12 A G 11: 78,025,045 D175G probably damaging Het
Plekhg6 T G 6: 125,375,792 I131L possibly damaging Het
Ptbp3 A G 4: 59,485,626 V95A probably damaging Het
Rbbp8 A G 18: 11,722,607 T604A probably benign Het
Rbbp8nl G A 2: 180,279,793 P266L possibly damaging Het
Ryr1 T C 7: 29,015,723 S4659G unknown Het
Serpinb9d A G 13: 33,196,440 probably null Het
Slc22a28 A C 19: 8,071,097 I395S possibly damaging Het
Slco6c1 T A 1: 97,127,931 I82L probably benign Het
Sptan1 C T 2: 29,986,492 R295* probably null Het
Tdrd9 C T 12: 111,997,902 probably null Het
Ube2v2 A G 16: 15,556,479 L77P possibly damaging Het
Ugt3a2 T C 15: 9,361,683 S182P probably damaging Het
Vwa5b1 T C 4: 138,608,890 E131G probably damaging Het
Wdr18 C T 10: 79,965,038 A145V probably benign Het
Zfp946 T A 17: 22,454,695 C143* probably null Het
Other mutations in Xpnpep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Xpnpep1 APN 19 53010148 missense probably benign 0.06
IGL01665:Xpnpep1 APN 19 52997032 missense probably benign 0.00
IGL01833:Xpnpep1 APN 19 53000393 missense probably damaging 1.00
IGL02011:Xpnpep1 APN 19 53002465 critical splice donor site probably benign 0.00
IGL03229:Xpnpep1 APN 19 53025380 missense probably benign
IGL03334:Xpnpep1 APN 19 53010146 missense probably damaging 1.00
R0226:Xpnpep1 UTSW 19 53010152 missense probably benign 0.03
R0613:Xpnpep1 UTSW 19 53006353 missense probably damaging 0.97
R0648:Xpnpep1 UTSW 19 52997863 splice site probably benign
R1543:Xpnpep1 UTSW 19 52991676 missense probably benign 0.24
R1553:Xpnpep1 UTSW 19 53006338 missense probably benign 0.00
R1801:Xpnpep1 UTSW 19 53010133 missense probably damaging 1.00
R1853:Xpnpep1 UTSW 19 53006210 missense probably benign 0.01
R2234:Xpnpep1 UTSW 19 53013461 missense probably damaging 1.00
R3797:Xpnpep1 UTSW 19 53006342 missense probably benign 0.28
R3820:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3822:Xpnpep1 UTSW 19 53003819 splice site probably benign
R3925:Xpnpep1 UTSW 19 52991697 missense probably damaging 1.00
R4831:Xpnpep1 UTSW 19 53014622 missense probably benign 0.09
R5033:Xpnpep1 UTSW 19 53006175 missense probably benign
R5184:Xpnpep1 UTSW 19 53013414 missense probably benign 0.24
R5468:Xpnpep1 UTSW 19 52995519 missense probably benign 0.01
R5876:Xpnpep1 UTSW 19 52997008 missense probably damaging 1.00
R5929:Xpnpep1 UTSW 19 53013489 missense probably damaging 1.00
R6454:Xpnpep1 UTSW 19 52997879 missense possibly damaging 0.91
R6519:Xpnpep1 UTSW 19 53011844 missense possibly damaging 0.90
R7095:Xpnpep1 UTSW 19 53011765 critical splice donor site probably null
R7112:Xpnpep1 UTSW 19 53010107 missense probably benign
R7412:Xpnpep1 UTSW 19 53006291 missense probably benign
R8329:Xpnpep1 UTSW 19 53002472 critical splice donor site probably null
R8431:Xpnpep1 UTSW 19 52995506 missense probably benign 0.04
RF017:Xpnpep1 UTSW 19 53032060 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CCACTGACTCTGGAAAACCTG -3'
(R):5'- AGGAGGATGTCTCACTGATGGG -3'

Sequencing Primer
(F):5'- CTGACTCTGGAAAACCTGAGGAC -3'
(R):5'- TGAACTCACGCTGTGCTGAAC -3'
Posted On2016-10-24