Incidental Mutation 'R5539:Nr4a3'
ID435813
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission 043097-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5539 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 48056525 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably null
Transcript: ENSMUST00000030025
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133539
Predicted Effect probably null
Transcript: ENSMUST00000153369
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Predicted Effect probably null
Transcript: ENSMUST00000153369
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,029 S44C probably damaging Het
Abca4 A G 3: 122,169,908 I846V probably damaging Het
Aldh4a1 T C 4: 139,638,522 S275P probably benign Het
Arhgap12 A T 18: 6,111,932 L144H probably benign Het
Ccdc141 A T 2: 77,015,093 I1210N probably damaging Het
Ccdc175 T C 12: 72,144,813 T330A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah17 T C 11: 118,073,660 K2444E probably benign Het
Dnajc3 G A 14: 118,970,747 V265M probably damaging Het
Flg2 T A 3: 93,220,446 Y2222N unknown Het
Flnc G T 6: 29,446,230 G882V probably damaging Het
Fndc5 T A 4: 129,138,721 V39D probably damaging Het
Gabrr3 A T 16: 59,461,395 H371L probably benign Het
Gm10717 A T 9: 3,030,438 H33L probably damaging Het
Gm5422 A G 10: 31,248,650 noncoding transcript Het
Kri1 G A 9: 21,279,372 Q280* probably null Het
Lcp1 T C 14: 75,229,298 V615A probably benign Het
Ltbp4 T C 7: 27,327,724 Y407C probably damaging Het
Med30 G T 15: 52,721,066 D127Y probably damaging Het
Mybpc2 A G 7: 44,514,893 V416A probably benign Het
Notch2 C T 3: 98,137,582 R1607C probably damaging Het
Ntf5 G T 7: 45,415,930 R162L probably benign Het
Nxpe3 A G 16: 55,890,671 W2R possibly damaging Het
Olfr115 T A 17: 37,610,755 M1L probably benign Het
Olfr24 G A 9: 18,754,838 R266C probably damaging Het
Olfr482 A T 7: 108,095,226 C115S probably benign Het
Olfr934 T C 9: 38,982,277 I256V possibly damaging Het
Pan2 C A 10: 128,308,133 D99E probably benign Het
Pcdh12 T C 18: 38,281,744 H776R possibly damaging Het
Prdm2 T C 4: 143,132,694 H1342R possibly damaging Het
Prpf8 A G 11: 75,503,638 T1800A probably benign Het
Prss40 T C 1: 34,552,679 *148W probably null Het
Pygo1 C T 9: 72,944,779 P83S probably damaging Het
Raf1 G T 6: 115,619,356 S619R probably damaging Het
Rtf1 A G 2: 119,729,924 M596V possibly damaging Het
Slc12a5 T A 2: 164,987,206 D578E possibly damaging Het
Slc35b4 A G 6: 34,176,802 V18A probably damaging Het
Spata31 T A 13: 64,922,969 I977K probably benign Het
Tor2a T C 2: 32,760,660 I222T probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Trip11 A G 12: 101,885,127 S893P probably damaging Het
Trmt10c G A 16: 56,034,961 P104S probably damaging Het
Ubr3 A T 2: 70,020,533 Y1765F probably damaging Het
Zfp951 C T 5: 104,814,846 E285K probably damaging Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6921:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7986:Nr4a3 UTSW 4 48055954 missense probably damaging 1.00
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8403:Nr4a3 UTSW 4 48051348 missense probably damaging 1.00
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCCATCACTGTTGAGCGCTG -3'
(R):5'- CTCTTGCTACCATGATCATGAATG -3'

Sequencing Primer
(F):5'- GAGCGCTGTTCCGAACTTAAC -3'
(R):5'- CTCTGGAATAATCAAGATCTCTGGG -3'
Posted On2016-10-24