Incidental Mutation 'R5539:Olfr934'
ID 435829
Institutional Source Beutler Lab
Gene Symbol Olfr934
Ensembl Gene ENSMUSG00000057424
Gene Name olfactory receptor 934
Synonyms MOR224-6, GA_x6K02T2PVTD-32678895-32677963
MMRRC Submission 043097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock # R5539 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 38981026-38988315 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38982277 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 256 (I256V)
Ref Sequence ENSEMBL: ENSMUSP00000150864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074211] [ENSMUST00000214324] [ENSMUST00000216238] [ENSMUST00000216823]
AlphaFold Q9EQ87
Predicted Effect possibly damaging
Transcript: ENSMUST00000074211
AA Change: I256V

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073835
Gene: ENSMUSG00000057424
AA Change: I256V

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.7e-48 PFAM
Pfam:7TM_GPCR_Srsx 33 222 7.2e-9 PFAM
Pfam:7tm_1 39 286 5.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214324
AA Change: I256V

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000216238
Predicted Effect possibly damaging
Transcript: ENSMUST00000216823
AA Change: I256V

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,029 S44C probably damaging Het
Abca4 A G 3: 122,169,908 I846V probably damaging Het
Aldh4a1 T C 4: 139,638,522 S275P probably benign Het
Arhgap12 A T 18: 6,111,932 L144H probably benign Het
Ccdc141 A T 2: 77,015,093 I1210N probably damaging Het
Ccdc175 T C 12: 72,144,813 T330A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah17 T C 11: 118,073,660 K2444E probably benign Het
Dnajc3 G A 14: 118,970,747 V265M probably damaging Het
Flg2 T A 3: 93,220,446 Y2222N unknown Het
Flnc G T 6: 29,446,230 G882V probably damaging Het
Fndc5 T A 4: 129,138,721 V39D probably damaging Het
Gabrr3 A T 16: 59,461,395 H371L probably benign Het
Gm10717 A T 9: 3,030,438 H33L probably damaging Het
Gm5422 A G 10: 31,248,650 noncoding transcript Het
Kri1 G A 9: 21,279,372 Q280* probably null Het
Lcp1 T C 14: 75,229,298 V615A probably benign Het
Ltbp4 T C 7: 27,327,724 Y407C probably damaging Het
Med30 G T 15: 52,721,066 D127Y probably damaging Het
Mybpc2 A G 7: 44,514,893 V416A probably benign Het
Notch2 C T 3: 98,137,582 R1607C probably damaging Het
Nr4a3 T A 4: 48,056,525 probably null Het
Ntf5 G T 7: 45,415,930 R162L probably benign Het
Nxpe3 A G 16: 55,890,671 W2R possibly damaging Het
Olfr115 T A 17: 37,610,755 M1L probably benign Het
Olfr24 G A 9: 18,754,838 R266C probably damaging Het
Olfr482 A T 7: 108,095,226 C115S probably benign Het
Pan2 C A 10: 128,308,133 D99E probably benign Het
Pcdh12 T C 18: 38,281,744 H776R possibly damaging Het
Prdm2 T C 4: 143,132,694 H1342R possibly damaging Het
Prpf8 A G 11: 75,503,638 T1800A probably benign Het
Prss40 T C 1: 34,552,679 *148W probably null Het
Pygo1 C T 9: 72,944,779 P83S probably damaging Het
Raf1 G T 6: 115,619,356 S619R probably damaging Het
Rtf1 A G 2: 119,729,924 M596V possibly damaging Het
Slc12a5 T A 2: 164,987,206 D578E possibly damaging Het
Slc35b4 A G 6: 34,176,802 V18A probably damaging Het
Spata31 T A 13: 64,922,969 I977K probably benign Het
Tor2a T C 2: 32,760,660 I222T probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Trip11 A G 12: 101,885,127 S893P probably damaging Het
Trmt10c G A 16: 56,034,961 P104S probably damaging Het
Ubr3 A T 2: 70,020,533 Y1765F probably damaging Het
Zfp951 C T 5: 104,814,846 E285K probably damaging Het
Other mutations in Olfr934
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02156:Olfr934 APN 9 38982546 missense possibly damaging 0.71
R1061:Olfr934 UTSW 9 38982483 missense probably damaging 1.00
R1604:Olfr934 UTSW 9 38982618 missense probably benign 0.01
R1776:Olfr934 UTSW 9 38982894 missense probably damaging 1.00
R3499:Olfr934 UTSW 9 38982465 missense probably damaging 1.00
R3761:Olfr934 UTSW 9 38982366 missense possibly damaging 0.94
R3876:Olfr934 UTSW 9 38982870 missense probably damaging 1.00
R4191:Olfr934 UTSW 9 38983017 missense probably benign 0.01
R4192:Olfr934 UTSW 9 38983017 missense probably benign 0.01
R4333:Olfr934 UTSW 9 38982588 missense possibly damaging 0.85
R4876:Olfr934 UTSW 9 38982626 nonsense probably null
R6916:Olfr934 UTSW 9 38982904 missense probably benign 0.14
R7097:Olfr934 UTSW 9 38982618 missense probably benign 0.01
R7338:Olfr934 UTSW 9 38982520 missense probably damaging 0.99
R8116:Olfr934 UTSW 9 38982873 missense probably damaging 1.00
R9350:Olfr934 UTSW 9 38982785 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCAGTGGTGACATCTGTG -3'
(R):5'- TAGAGATGGTGGGTCTCATCAG -3'

Sequencing Primer
(F):5'- GACATCTGTGTTATGTATTGCACAG -3'
(R):5'- GTCTCATCAGTGTGGGGC -3'
Posted On 2016-10-24