Incidental Mutation 'R5539:Lcp1'
ID 435840
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Name lymphocyte cytosolic protein 1
Synonyms D14Ertd310e, L-fimbrin, Pls2, L-plastin
MMRRC Submission 043097-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5539 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 75131101-75230842 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75229298 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 615 (V615A)
Ref Sequence ENSEMBL: ENSMUSP00000116271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124499] [ENSMUST00000131802] [ENSMUST00000145303]
AlphaFold Q61233
Predicted Effect probably benign
Transcript: ENSMUST00000124499
AA Change: V615A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: V615A

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131802
AA Change: V615A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: V615A

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145303
AA Change: V615A

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: V615A

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,029 S44C probably damaging Het
Abca4 A G 3: 122,169,908 I846V probably damaging Het
Aldh4a1 T C 4: 139,638,522 S275P probably benign Het
Arhgap12 A T 18: 6,111,932 L144H probably benign Het
Ccdc141 A T 2: 77,015,093 I1210N probably damaging Het
Ccdc175 T C 12: 72,144,813 T330A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah17 T C 11: 118,073,660 K2444E probably benign Het
Dnajc3 G A 14: 118,970,747 V265M probably damaging Het
Flg2 T A 3: 93,220,446 Y2222N unknown Het
Flnc G T 6: 29,446,230 G882V probably damaging Het
Fndc5 T A 4: 129,138,721 V39D probably damaging Het
Gabrr3 A T 16: 59,461,395 H371L probably benign Het
Gm10717 A T 9: 3,030,438 H33L probably damaging Het
Gm5422 A G 10: 31,248,650 noncoding transcript Het
Kri1 G A 9: 21,279,372 Q280* probably null Het
Ltbp4 T C 7: 27,327,724 Y407C probably damaging Het
Med30 G T 15: 52,721,066 D127Y probably damaging Het
Mybpc2 A G 7: 44,514,893 V416A probably benign Het
Notch2 C T 3: 98,137,582 R1607C probably damaging Het
Nr4a3 T A 4: 48,056,525 probably null Het
Ntf5 G T 7: 45,415,930 R162L probably benign Het
Nxpe3 A G 16: 55,890,671 W2R possibly damaging Het
Olfr115 T A 17: 37,610,755 M1L probably benign Het
Olfr24 G A 9: 18,754,838 R266C probably damaging Het
Olfr482 A T 7: 108,095,226 C115S probably benign Het
Olfr934 T C 9: 38,982,277 I256V possibly damaging Het
Pan2 C A 10: 128,308,133 D99E probably benign Het
Pcdh12 T C 18: 38,281,744 H776R possibly damaging Het
Prdm2 T C 4: 143,132,694 H1342R possibly damaging Het
Prpf8 A G 11: 75,503,638 T1800A probably benign Het
Prss40 T C 1: 34,552,679 *148W probably null Het
Pygo1 C T 9: 72,944,779 P83S probably damaging Het
Raf1 G T 6: 115,619,356 S619R probably damaging Het
Rtf1 A G 2: 119,729,924 M596V possibly damaging Het
Slc12a5 T A 2: 164,987,206 D578E possibly damaging Het
Slc35b4 A G 6: 34,176,802 V18A probably damaging Het
Spata31 T A 13: 64,922,969 I977K probably benign Het
Tor2a T C 2: 32,760,660 I222T probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Trip11 A G 12: 101,885,127 S893P probably damaging Het
Trmt10c G A 16: 56,034,961 P104S probably damaging Het
Ubr3 A T 2: 70,020,533 Y1765F probably damaging Het
Zfp951 C T 5: 104,814,846 E285K probably damaging Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75227093 critical splice donor site probably null
IGL01768:Lcp1 APN 14 75224133 missense probably benign 0.40
IGL01801:Lcp1 APN 14 75199375 missense probably benign 0.10
IGL01940:Lcp1 APN 14 75216365 missense probably benign 0.17
IGL02135:Lcp1 APN 14 75200486 missense probably benign 0.00
IGL02185:Lcp1 APN 14 75229300 missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75224096 missense probably benign 0.04
IGL02604:Lcp1 APN 14 75224126 missense probably benign 0.11
R0244:Lcp1 UTSW 14 75227001 missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75199420 missense probably null 0.59
R0313:Lcp1 UTSW 14 75199433 missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75227006 missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R0811:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R0812:Lcp1 UTSW 14 75214488 missense probably benign 0.00
R1200:Lcp1 UTSW 14 75229302 missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75199444 critical splice donor site probably null
R1915:Lcp1 UTSW 14 75199297 missense possibly damaging 0.81
R1969:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1970:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75200506 missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75200401 missense probably benign 0.01
R2064:Lcp1 UTSW 14 75198075 critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75206129 missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75215180 missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75215168 missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75200408 missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75200489 missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75208471 nonsense probably null
R5561:Lcp1 UTSW 14 75212508 missense probably benign 0.01
R5724:Lcp1 UTSW 14 75226982 missense probably benign 0.18
R5989:Lcp1 UTSW 14 75199387 missense probably benign 0.00
R6731:Lcp1 UTSW 14 75206189 missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75210506 missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75200431 missense probably benign 0.12
R7698:Lcp1 UTSW 14 75206211 nonsense probably null
R9780:Lcp1 UTSW 14 75202738 missense probably damaging 1.00
S24628:Lcp1 UTSW 14 75227006 missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75227086 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGAGAGAAGGTCCAACTG -3'
(R):5'- CAGAAGCTACTTGGCTGAAGAAATG -3'

Sequencing Primer
(F):5'- GGTCCAACTGGCAAAGTGC -3'
(R):5'- CTTGGCTGAAGAAATGTGTGAATTTC -3'
Posted On 2016-10-24