Incidental Mutation 'R5539:Nxpe3'
ID435843
Institutional Source Beutler Lab
Gene Symbol Nxpe3
Ensembl Gene ENSMUSG00000075033
Gene Nameneurexophilin and PC-esterase domain family, member 3
SynonymsFam55c, LOC208684, LOC385658
MMRRC Submission 043097-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5539 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location55839953-55895285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55890671 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 2 (W2R)
Ref Sequence ENSEMBL: ENSMUSP00000097296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099705]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099705
AA Change: W2R

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097296
Gene: ENSMUSG00000075033
AA Change: W2R

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Neurexophilin 73 284 2.9e-64 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexophilin family of neuropeptide-like glycoproteins. The encoded protein contains a variable N-terminal domain, a highly conserved neurexophilin and PC-esterase (NXPE) central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein binds alpha neurexins, a group of presynaptic transmembrane receptors that promote adhesion between dendrites and axons. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310034C09Rik A T 16: 88,759,029 S44C probably damaging Het
Abca4 A G 3: 122,169,908 I846V probably damaging Het
Aldh4a1 T C 4: 139,638,522 S275P probably benign Het
Arhgap12 A T 18: 6,111,932 L144H probably benign Het
Ccdc141 A T 2: 77,015,093 I1210N probably damaging Het
Ccdc175 T C 12: 72,144,813 T330A probably benign Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dnah17 T C 11: 118,073,660 K2444E probably benign Het
Dnajc3 G A 14: 118,970,747 V265M probably damaging Het
Flg2 T A 3: 93,220,446 Y2222N unknown Het
Flnc G T 6: 29,446,230 G882V probably damaging Het
Fndc5 T A 4: 129,138,721 V39D probably damaging Het
Gabrr3 A T 16: 59,461,395 H371L probably benign Het
Gm10717 A T 9: 3,030,438 H33L probably damaging Het
Gm5422 A G 10: 31,248,650 noncoding transcript Het
Kri1 G A 9: 21,279,372 Q280* probably null Het
Lcp1 T C 14: 75,229,298 V615A probably benign Het
Ltbp4 T C 7: 27,327,724 Y407C probably damaging Het
Med30 G T 15: 52,721,066 D127Y probably damaging Het
Mybpc2 A G 7: 44,514,893 V416A probably benign Het
Notch2 C T 3: 98,137,582 R1607C probably damaging Het
Nr4a3 T A 4: 48,056,525 probably null Het
Ntf5 G T 7: 45,415,930 R162L probably benign Het
Olfr115 T A 17: 37,610,755 M1L probably benign Het
Olfr24 G A 9: 18,754,838 R266C probably damaging Het
Olfr482 A T 7: 108,095,226 C115S probably benign Het
Olfr934 T C 9: 38,982,277 I256V possibly damaging Het
Pan2 C A 10: 128,308,133 D99E probably benign Het
Pcdh12 T C 18: 38,281,744 H776R possibly damaging Het
Prdm2 T C 4: 143,132,694 H1342R possibly damaging Het
Prpf8 A G 11: 75,503,638 T1800A probably benign Het
Prss40 T C 1: 34,552,679 *148W probably null Het
Pygo1 C T 9: 72,944,779 P83S probably damaging Het
Raf1 G T 6: 115,619,356 S619R probably damaging Het
Rtf1 A G 2: 119,729,924 M596V possibly damaging Het
Slc12a5 T A 2: 164,987,206 D578E possibly damaging Het
Slc35b4 A G 6: 34,176,802 V18A probably damaging Het
Spata31 T A 13: 64,922,969 I977K probably benign Het
Tor2a T C 2: 32,760,660 I222T probably damaging Het
Trim23 T C 13: 104,198,033 V347A probably damaging Het
Trip11 A G 12: 101,885,127 S893P probably damaging Het
Trmt10c G A 16: 56,034,961 P104S probably damaging Het
Ubr3 A T 2: 70,020,533 Y1765F probably damaging Het
Zfp951 C T 5: 104,814,846 E285K probably damaging Het
Other mutations in Nxpe3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Nxpe3 APN 16 55844232 missense probably damaging 0.98
IGL01743:Nxpe3 APN 16 55849765 missense probably benign 0.00
IGL02355:Nxpe3 APN 16 55890586 missense probably benign 0.11
IGL02362:Nxpe3 APN 16 55890586 missense probably benign 0.11
IGL02750:Nxpe3 APN 16 55860375 missense probably benign 0.21
IGL02792:Nxpe3 APN 16 55866172 missense probably damaging 0.98
IGL03383:Nxpe3 APN 16 55849713 missense probably benign 0.00
R0126:Nxpe3 UTSW 16 55866229 missense possibly damaging 0.94
R0348:Nxpe3 UTSW 16 55866535 missense probably benign 0.01
R0526:Nxpe3 UTSW 16 55866517 missense possibly damaging 0.86
R1752:Nxpe3 UTSW 16 55866474 missense probably benign
R1830:Nxpe3 UTSW 16 55866081 missense probably damaging 1.00
R2285:Nxpe3 UTSW 16 55866225 missense probably damaging 1.00
R3196:Nxpe3 UTSW 16 55849715 missense probably damaging 0.99
R4863:Nxpe3 UTSW 16 55849633 missense probably damaging 1.00
R4922:Nxpe3 UTSW 16 55860324 missense probably benign
R5308:Nxpe3 UTSW 16 55866471 missense probably benign 0.43
R5338:Nxpe3 UTSW 16 55866343 missense possibly damaging 0.52
R5780:Nxpe3 UTSW 16 55866441 missense probably damaging 1.00
R5877:Nxpe3 UTSW 16 55866201 missense probably damaging 1.00
R6769:Nxpe3 UTSW 16 55866108 missense probably damaging 1.00
R6771:Nxpe3 UTSW 16 55866108 missense probably damaging 1.00
R6841:Nxpe3 UTSW 16 55844322 missense possibly damaging 0.65
R7660:Nxpe3 UTSW 16 55844327 missense probably damaging 0.96
Z1177:Nxpe3 UTSW 16 55866222 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTTGCTCCCTCACACAGAG -3'
(R):5'- AAATGAACTTCTTCGGTTGCAG -3'

Sequencing Primer
(F):5'- AGCAAAAGGTCTACTGACTCTTCCTG -3'
(R):5'- GTACAGAACATGCCTCTTGAATCG -3'
Posted On2016-10-24