Incidental Mutation 'R5540:Rusc2'
Institutional Source Beutler Lab
Gene Symbol Rusc2
Ensembl Gene ENSMUSG00000035969
Gene NameRUN and SH3 domain containing 2
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R5540 (G1)
Quality Score225
Status Not validated
Chromosomal Location43381979-43427088 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43423975 bp
Amino Acid Change Tyrosine to Cysteine at position 1043 (Y1043C)
Ref Sequence ENSEMBL: ENSMUSP00000118528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035645] [ENSMUST00000052829] [ENSMUST00000098106] [ENSMUST00000107928] [ENSMUST00000107929] [ENSMUST00000131668] [ENSMUST00000149221] [ENSMUST00000149676] [ENSMUST00000171134] [ENSMUST00000173682]
Predicted Effect probably damaging
Transcript: ENSMUST00000035645
AA Change: Y1043C

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038379
Gene: ENSMUSG00000035969
AA Change: Y1043C

low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052829
SMART Domains Protein: ENSMUSP00000058980
Gene: ENSMUSG00000042788

Pfam:DUF2475 15 47 2.9e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098106
AA Change: Y1043C

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095710
Gene: ENSMUSG00000035969
AA Change: Y1043C

low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
SH3 1457 1512 7.4e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107928
SMART Domains Protein: ENSMUSP00000103561
Gene: ENSMUSG00000042788

Pfam:DUF2475 15 76 1.3e-20 PFAM
Pfam:DUF2475 212 251 6.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107929
SMART Domains Protein: ENSMUSP00000103562
Gene: ENSMUSG00000042788

Pfam:DUF2475 15 76 1.5e-20 PFAM
Pfam:DUF2475 232 271 7.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125393
Predicted Effect probably damaging
Transcript: ENSMUST00000131668
AA Change: Y1043C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118528
Gene: ENSMUSG00000035969
AA Change: Y1043C

low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 600 617 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
RUN 1109 1177 3.66e-21 SMART
low complexity region 1235 1260 N/A INTRINSIC
low complexity region 1289 1324 N/A INTRINSIC
low complexity region 1330 1341 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146710
Predicted Effect probably benign
Transcript: ENSMUST00000149221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149556
Predicted Effect probably benign
Transcript: ENSMUST00000149676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154754
Predicted Effect probably benign
Transcript: ENSMUST00000155080
Predicted Effect probably benign
Transcript: ENSMUST00000171134
SMART Domains Protein: ENSMUSP00000127145
Gene: ENSMUSG00000042788

Pfam:DUF2475 15 76 7.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173682
SMART Domains Protein: ENSMUSP00000133715
Gene: ENSMUSG00000035969

low complexity region 39 47 N/A INTRINSIC
low complexity region 212 230 N/A INTRINSIC
low complexity region 253 265 N/A INTRINSIC
low complexity region 411 427 N/A INTRINSIC
low complexity region 435 448 N/A INTRINSIC
low complexity region 530 544 N/A INTRINSIC
low complexity region 685 703 N/A INTRINSIC
low complexity region 733 740 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a RUN and SH3 domain containing protein that interacts with Rab1b and Rab1-binding protein GM130. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Arid1a A C 4: 133,680,454 D2247E unknown Het
Asph A G 4: 9,635,906 L77S probably damaging Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Crebrf A G 17: 26,742,097 D56G possibly damaging Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Hpx A G 7: 105,591,912 S385P possibly damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Me1 A G 9: 86,679,873 L53P possibly damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Serpinb6b A T 13: 32,977,558 K86* probably null Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tbx4 A T 11: 85,911,168 N209I possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Vps16 T A 2: 130,442,385 D685E probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr59 A G 8: 111,485,184 L377P possibly damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Rusc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Rusc2 APN 4 43426116 missense probably damaging 0.97
IGL01474:Rusc2 APN 4 43416434 missense probably damaging 0.98
IGL01541:Rusc2 APN 4 43415840 missense probably benign 0.08
IGL01628:Rusc2 APN 4 43425729 missense probably damaging 1.00
IGL01969:Rusc2 APN 4 43415738 missense probably benign 0.02
IGL02030:Rusc2 APN 4 43416095 missense possibly damaging 0.86
IGL02079:Rusc2 APN 4 43425668 missense probably benign
IGL02115:Rusc2 APN 4 43426136 splice site probably benign
IGL02122:Rusc2 APN 4 43421685 missense possibly damaging 0.67
IGL02350:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02357:Rusc2 APN 4 43425351 missense possibly damaging 0.86
IGL02437:Rusc2 APN 4 43415545 missense probably damaging 1.00
IGL02930:Rusc2 APN 4 43416376 missense probably damaging 0.99
IGL03154:Rusc2 APN 4 43425806 missense probably benign 0.00
P0026:Rusc2 UTSW 4 43415840 missense possibly damaging 0.93
R0036:Rusc2 UTSW 4 43424009 missense probably damaging 1.00
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0068:Rusc2 UTSW 4 43424100 splice site probably benign
R0114:Rusc2 UTSW 4 43422055 missense probably damaging 1.00
R0255:Rusc2 UTSW 4 43423954 missense probably damaging 1.00
R0471:Rusc2 UTSW 4 43425486 missense probably damaging 0.99
R1381:Rusc2 UTSW 4 43416137 missense probably damaging 1.00
R1413:Rusc2 UTSW 4 43416568 missense probably benign 0.00
R1416:Rusc2 UTSW 4 43421617 missense possibly damaging 0.86
R1731:Rusc2 UTSW 4 43426046 missense probably benign
R1864:Rusc2 UTSW 4 43421719 missense possibly damaging 0.49
R1897:Rusc2 UTSW 4 43421749 missense probably damaging 1.00
R2010:Rusc2 UTSW 4 43415212 missense probably benign 0.06
R2212:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R2275:Rusc2 UTSW 4 43416260 missense probably damaging 1.00
R2885:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R2886:Rusc2 UTSW 4 43415456 missense probably benign 0.28
R3412:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3413:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3414:Rusc2 UTSW 4 43415935 missense probably damaging 1.00
R3852:Rusc2 UTSW 4 43416424 missense probably benign 0.45
R4135:Rusc2 UTSW 4 43425563 missense possibly damaging 0.49
R4272:Rusc2 UTSW 4 43415533 missense probably damaging 1.00
R4574:Rusc2 UTSW 4 43416080 missense probably damaging 0.99
R4888:Rusc2 UTSW 4 43423942 missense probably damaging 1.00
R5010:Rusc2 UTSW 4 43415926 missense probably damaging 1.00
R5071:Rusc2 UTSW 4 43415240 missense probably benign 0.05
R5131:Rusc2 UTSW 4 43414948 missense probably benign 0.03
R5177:Rusc2 UTSW 4 43421805 splice site probably null
R5561:Rusc2 UTSW 4 43415932 nonsense probably null
R5628:Rusc2 UTSW 4 43425348 missense probably damaging 1.00
R5645:Rusc2 UTSW 4 43425758 missense probably benign 0.06
R6129:Rusc2 UTSW 4 43424271 missense probably damaging 1.00
R6362:Rusc2 UTSW 4 43416416 missense probably benign 0.30
R6633:Rusc2 UTSW 4 43414852 missense probably damaging 0.99
R6980:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R7491:Rusc2 UTSW 4 43426528 missense probably damaging 1.00
R7641:Rusc2 UTSW 4 43425335 missense possibly damaging 0.84
R7698:Rusc2 UTSW 4 43414900 nonsense probably null
R7710:Rusc2 UTSW 4 43416119 missense probably benign 0.07
R8052:Rusc2 UTSW 4 43421851 missense probably benign
R8061:Rusc2 UTSW 4 43422492 missense probably damaging 1.00
R8127:Rusc2 UTSW 4 43423747 missense possibly damaging 0.54
R8319:Rusc2 UTSW 4 43425378 missense probably damaging 1.00
R8355:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8397:Rusc2 UTSW 4 43424206 missense possibly damaging 0.95
R8455:Rusc2 UTSW 4 43422846 missense probably benign 0.35
R8553:Rusc2 UTSW 4 43416508 missense probably benign 0.05
R8725:Rusc2 UTSW 4 43401351 intron probably benign
R8725:Rusc2 UTSW 4 43415396 missense probably damaging 0.99
R8727:Rusc2 UTSW 4 43401351 intron probably benign
X0025:Rusc2 UTSW 4 43422226 missense probably benign 0.00
X0066:Rusc2 UTSW 4 43422204 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-10-24