Incidental Mutation 'R5540:Hpx'
ID435882
Institutional Source Beutler Lab
Gene Symbol Hpx
Ensembl Gene ENSMUSG00000030895
Gene Namehemopexin
SynonymsHpxn, hx
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5540 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105591613-105600137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105591912 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 385 (S385P)
Ref Sequence ENSEMBL: ENSMUSP00000033185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033185] [ENSMUST00000210531]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033185
AA Change: S385P

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895
AA Change: S385P

DomainStartEndE-ValueType
HX 56 93 1.29e0 SMART
HX 97 140 5.52e-8 SMART
Blast:HX 143 186 3e-7 BLAST
HX 187 230 3.48e-5 SMART
HX 261 304 1.07e-5 SMART
HX 306 351 5.49e-3 SMART
Blast:HX 358 403 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000210531
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, they have increased susceptiblity to induced hemolytic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Arid1a A C 4: 133,680,454 D2247E unknown Het
Asph A G 4: 9,635,906 L77S probably damaging Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Crebrf A G 17: 26,742,097 D56G possibly damaging Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Me1 A G 9: 86,679,873 L53P possibly damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Rusc2 A G 4: 43,423,975 Y1043C probably damaging Het
Serpinb6b A T 13: 32,977,558 K86* probably null Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tbx4 A T 11: 85,911,168 N209I possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Vps16 T A 2: 130,442,385 D685E probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr59 A G 8: 111,485,184 L377P possibly damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Hpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Hpx APN 7 105591770 missense probably damaging 1.00
IGL01861:Hpx APN 7 105592186 nonsense probably null
IGL02441:Hpx APN 7 105592223 missense probably damaging 1.00
IGL03117:Hpx APN 7 105600071 missense possibly damaging 0.94
IGL03230:Hpx APN 7 105599312 missense probably benign 0.04
IGL03376:Hpx APN 7 105592251 unclassified probably benign
IGL03392:Hpx APN 7 105592402 missense probably damaging 1.00
PIT4520001:Hpx UTSW 7 105592134 missense probably benign 0.00
R0138:Hpx UTSW 7 105592238 missense probably damaging 1.00
R0364:Hpx UTSW 7 105596264 missense probably benign 0.18
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1958:Hpx UTSW 7 105596396 missense probably damaging 1.00
R2007:Hpx UTSW 7 105595574 missense probably damaging 1.00
R2025:Hpx UTSW 7 105595104 missense probably damaging 1.00
R2173:Hpx UTSW 7 105592083 missense probably benign 0.01
R2207:Hpx UTSW 7 105592426 missense probably damaging 1.00
R3162:Hpx UTSW 7 105599640 intron probably benign
R3849:Hpx UTSW 7 105596291 missense probably damaging 1.00
R4206:Hpx UTSW 7 105595147 missense probably null 0.01
R4510:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4511:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4709:Hpx UTSW 7 105600036 missense probably benign 0.05
R5029:Hpx UTSW 7 105591764 missense probably damaging 1.00
R5631:Hpx UTSW 7 105595601 missense probably damaging 0.96
R5664:Hpx UTSW 7 105595148 missense probably benign 0.02
R5820:Hpx UTSW 7 105591788 missense possibly damaging 0.89
R5922:Hpx UTSW 7 105595624 missense probably damaging 1.00
R6707:Hpx UTSW 7 105595475 missense probably benign 0.09
R6714:Hpx UTSW 7 105595095 missense probably damaging 0.98
R7356:Hpx UTSW 7 105591710 missense probably damaging 0.99
R7425:Hpx UTSW 7 105591861 missense probably damaging 1.00
X0066:Hpx UTSW 7 105596387 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGATGCTGTTCACCTTCTGAG -3'
(R):5'- AGGCTCTATGTCTCATCAGGTG -3'

Sequencing Primer
(F):5'- GCAGACTCTTGGCTGCATTCAG -3'
(R):5'- ATCAGGTGAGGTGCTTTTGGGTAC -3'
Posted On2016-10-24