Incidental Mutation 'R5540:Me1'
ID435892
Institutional Source Beutler Lab
Gene Symbol Me1
Ensembl Gene ENSMUSG00000032418
Gene Namemalic enzyme 1, NADP(+)-dependent, cytosolic
SynonymsMod-1, Mdh-1, Mod1, D9Ertd267e
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5540 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location86581371-86695953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86679873 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 53 (L53P)
Ref Sequence ENSEMBL: ENSMUSP00000034989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034989] [ENSMUST00000185374]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034989
AA Change: L53P

PolyPhen 2 Score 0.598 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034989
Gene: ENSMUSG00000032418
AA Change: L53P

DomainStartEndE-ValueType
malic 79 260 7.34e-106 SMART
Malic_M 270 522 1.09e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185374
AA Change: L33P

PolyPhen 2 Score 0.291 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140887
Gene: ENSMUSG00000032418
AA Change: L33P

DomainStartEndE-ValueType
malic 59 240 7.34e-106 SMART
Malic_M 250 502 1.09e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193572
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, NADP-dependent enzyme that generates NADPH for fatty acid biosynthesis. The activity of this enzyme, the reversible oxidative decarboxylation of malate, links the glycolytic and citric acid cycles. The regulation of expression for this gene is complex. Increased expression can result from elevated levels of thyroid hormones or by higher proportions of carbohydrates in the diet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit decreased body weight on a medium fat diet, altered cytoplasmic malic enzyme activity, and a male-specific reduction in food intake on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Arid1a A C 4: 133,680,454 D2247E unknown Het
Asph A G 4: 9,635,906 L77S probably damaging Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Crebrf A G 17: 26,742,097 D56G possibly damaging Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Hpx A G 7: 105,591,912 S385P possibly damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Rusc2 A G 4: 43,423,975 Y1043C probably damaging Het
Serpinb6b A T 13: 32,977,558 K86* probably null Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tbx4 A T 11: 85,911,168 N209I possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Vps16 T A 2: 130,442,385 D685E probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr59 A G 8: 111,485,184 L377P possibly damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Me1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Me1 APN 9 86598748 missense probably damaging 1.00
IGL01326:Me1 APN 9 86598718 critical splice donor site probably null
IGL02231:Me1 APN 9 86611855 missense possibly damaging 0.92
IGL02343:Me1 APN 9 86654641 critical splice donor site probably null
IGL02444:Me1 APN 9 86582914 splice site probably benign
IGL02655:Me1 APN 9 86654727 splice site probably benign
IGL03282:Me1 APN 9 86613596 missense probably damaging 0.99
R0116:Me1 UTSW 9 86654667 missense probably benign 0.01
R0270:Me1 UTSW 9 86596204 splice site probably benign
R0361:Me1 UTSW 9 86651002 missense probably damaging 1.00
R1535:Me1 UTSW 9 86587043 missense probably damaging 0.96
R1601:Me1 UTSW 9 86678012 missense probably damaging 1.00
R1807:Me1 UTSW 9 86650879 missense probably damaging 0.98
R2085:Me1 UTSW 9 86613554 missense probably damaging 1.00
R2571:Me1 UTSW 9 86654698 missense probably damaging 1.00
R3012:Me1 UTSW 9 86611912 missense probably benign 0.00
R4649:Me1 UTSW 9 86679852 missense probably benign 0.00
R6129:Me1 UTSW 9 86650956 missense probably damaging 1.00
R6727:Me1 UTSW 9 86582798 missense possibly damaging 0.92
R7718:Me1 UTSW 9 86679900 missense probably damaging 1.00
R8329:Me1 UTSW 9 86619737 missense probably damaging 1.00
RF001:Me1 UTSW 9 86582823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTATCTGCAAACAAATTCTCCTC -3'
(R):5'- TAGTGTCTGCGGCTAAGGAAG -3'

Sequencing Primer
(F):5'- CTCCTCAAAGTTAACTAATCCATTCC -3'
(R):5'- TAGTGCACAGTTGGCCG -3'
Posted On2016-10-24