Incidental Mutation 'R5540:Serpinb6b'
ID 435916
Institutional Source Beutler Lab
Gene Symbol Serpinb6b
Ensembl Gene ENSMUSG00000042842
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms NK13, ovalbumin, Spi12
MMRRC Submission 043098-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock # R5540 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 32965209-32979067 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 32977558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 86 (K86*)
Ref Sequence ENSEMBL: ENSMUSP00000152419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017184] [ENSMUST00000110293] [ENSMUST00000164541]
AlphaFold O08804
Predicted Effect probably benign
Transcript: ENSMUST00000017184
AA Change: E207V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000017184
Gene: ENSMUSG00000042842
AA Change: E207V

DomainStartEndE-ValueType
SERPIN 13 208 1.22e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110293
AA Change: K205*
SMART Domains Protein: ENSMUSP00000105922
Gene: ENSMUSG00000042842
AA Change: K205*

DomainStartEndE-ValueType
SERPIN 13 377 1.99e-174 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164541
AA Change: K86*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,362,947 S15P probably damaging Het
Actl7a A T 4: 56,744,388 H305L probably benign Het
Adam26b C A 8: 43,521,617 C116F probably damaging Het
Adgrl2 A G 3: 148,837,562 probably null Het
Akr1b10 A G 6: 34,394,112 T238A probably damaging Het
Akr1c18 A G 13: 4,137,179 V186A probably benign Het
Alpk3 G A 7: 81,095,436 V1311M probably damaging Het
Aox1 A G 1: 58,104,410 N1229S probably benign Het
Apobec3 T A 15: 79,897,919 N43K probably benign Het
Arid1a A C 4: 133,680,454 D2247E unknown Het
Asph A G 4: 9,635,906 L77S probably damaging Het
Cd300ld T A 11: 114,987,405 T94S probably damaging Het
Celf2 T C 2: 6,553,932 T382A probably benign Het
Cfap54 C T 10: 92,972,608 A1402T possibly damaging Het
Chrnb1 A T 11: 69,795,650 V48E probably benign Het
Col6a5 T A 9: 105,862,776 E2548V probably benign Het
Crebrf A G 17: 26,742,097 D56G possibly damaging Het
Dctn5 A G 7: 122,135,052 T40A probably benign Het
Dmxl2 A T 9: 54,393,857 N2323K probably benign Het
Dync1h1 A G 12: 110,660,950 Q4021R probably benign Het
Dyrk1a T G 16: 94,685,343 probably null Het
Ephb3 T A 16: 21,220,860 F454Y probably damaging Het
Fam71b A G 11: 46,404,888 N29S probably damaging Het
Fbxo38 A G 18: 62,514,793 probably null Het
Flg T C 3: 93,277,616 F15S probably damaging Het
Fndc3b G A 3: 27,501,502 P301L probably damaging Het
Fpr-rs7 C T 17: 20,114,094 G45R probably damaging Het
Gfi1 T A 5: 107,720,125 T360S probably damaging Het
Grik4 T C 9: 42,520,947 H918R probably damaging Het
Hpx A G 7: 105,591,912 S385P possibly damaging Het
Kdm5b A G 1: 134,631,241 D1501G probably damaging Het
Kif20b A T 19: 34,938,460 M546L probably benign Het
Map3k9 G T 12: 81,772,813 N222K probably damaging Het
Me1 A G 9: 86,679,873 L53P possibly damaging Het
Mis18bp1 T C 12: 65,148,746 E748G possibly damaging Het
Morc3 T A 16: 93,847,380 N186K probably benign Het
Mtor A G 4: 148,454,708 T221A probably benign Het
Muc6 A G 7: 141,649,585 probably null Het
Myh8 C A 11: 67,286,440 T444N probably benign Het
Myo7b A G 18: 32,007,090 Y216H probably damaging Het
Myom1 G A 17: 71,109,787 V1382M probably damaging Het
Nbeal2 A T 9: 110,631,733 Y1718N probably damaging Het
Npc1l1 A G 11: 6,214,546 S1168P probably damaging Het
Olfr1431 T A 19: 12,210,460 I298N probably damaging Het
Olfr463 T A 11: 87,893,685 K80* probably null Het
Olfr48 A G 2: 89,844,667 F102S probably damaging Het
Olfr561 C T 7: 102,774,929 A135V probably benign Het
Olfr765 G T 10: 129,046,495 D189E probably damaging Het
Pcdha4 C A 18: 36,954,837 A691E probably benign Het
Pde6a T G 18: 61,231,366 F165V probably damaging Het
Pqlc2 A T 4: 139,300,344 L229Q probably damaging Het
Ptpn14 A T 1: 189,846,364 M340L probably benign Het
Rnasel G T 1: 153,755,144 E469* probably null Het
Rsph3a T G 17: 7,945,958 L50R probably benign Het
Rusc2 A G 4: 43,423,975 Y1043C probably damaging Het
Serpine1 T C 5: 137,063,209 T392A probably benign Het
Shcbp1 A T 8: 4,744,529 D421E probably damaging Het
Slc24a1 A G 9: 64,948,581 V348A unknown Het
Slc26a7 A G 4: 14,506,621 F605L probably benign Het
Spag17 A C 3: 100,056,272 E1102A possibly damaging Het
Stab2 A G 10: 86,848,125 V2390A probably benign Het
Stk11 A G 10: 80,126,049 I35V probably benign Het
Stk24 T C 14: 121,294,281 D321G possibly damaging Het
Tbx4 A T 11: 85,911,168 N209I possibly damaging Het
Tmem225 T C 9: 40,149,385 L80P probably damaging Het
Tnfrsf4 C T 4: 156,013,923 T17I probably benign Het
Traf3ip1 G A 1: 91,501,315 R268Q probably benign Het
Trhde T A 10: 114,800,592 I237F probably benign Het
Ugt2a1 A T 5: 87,486,056 W231R probably damaging Het
Vash1 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 12: 86,680,057 probably benign Het
Vps16 T A 2: 130,442,385 D685E probably benign Het
Washc4 A G 10: 83,573,793 D602G probably damaging Het
Wdr59 A G 8: 111,485,184 L377P possibly damaging Het
Wdr81 T C 11: 75,449,070 E1364G probably damaging Het
Other mutations in Serpinb6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Serpinb6b APN 13 32971546 missense probably benign 0.01
IGL01077:Serpinb6b APN 13 32978066 missense possibly damaging 0.68
IGL01553:Serpinb6b APN 13 32974948 missense probably damaging 1.00
IGL02981:Serpinb6b APN 13 32971606 missense probably benign 0.34
R0308:Serpinb6b UTSW 13 32978237 missense probably benign 0.09
R1568:Serpinb6b UTSW 13 32974912 missense probably damaging 1.00
R1692:Serpinb6b UTSW 13 32974995 missense probably damaging 1.00
R1763:Serpinb6b UTSW 13 32978058 missense probably damaging 1.00
R1917:Serpinb6b UTSW 13 32978240 missense probably benign
R1918:Serpinb6b UTSW 13 32978240 missense probably benign
R1919:Serpinb6b UTSW 13 32978240 missense probably benign
R1920:Serpinb6b UTSW 13 32975008 missense possibly damaging 0.47
R3032:Serpinb6b UTSW 13 32968568 missense possibly damaging 0.78
R4239:Serpinb6b UTSW 13 32972263 missense probably damaging 0.96
R5089:Serpinb6b UTSW 13 32978150 missense probably benign
R5503:Serpinb6b UTSW 13 32977659 missense possibly damaging 0.95
R6061:Serpinb6b UTSW 13 32977994 missense probably damaging 0.99
R6253:Serpinb6b UTSW 13 32972272 missense probably damaging 1.00
R7156:Serpinb6b UTSW 13 32971615 missense probably benign 0.09
R7248:Serpinb6b UTSW 13 32977576 missense probably benign 0.23
R7315:Serpinb6b UTSW 13 32972257 missense probably benign 0.41
R7424:Serpinb6b UTSW 13 32968667 missense probably damaging 0.99
R7547:Serpinb6b UTSW 13 32974924 missense probably benign 0.05
R7732:Serpinb6b UTSW 13 32968607 missense probably damaging 1.00
R7770:Serpinb6b UTSW 13 32977529 missense probably benign 0.05
R7802:Serpinb6b UTSW 13 32971596
R8814:Serpinb6b UTSW 13 32978304 missense possibly damaging 0.94
R8966:Serpinb6b UTSW 13 32978052 missense probably damaging 1.00
R8988:Serpinb6b UTSW 13 32978142 missense probably benign 0.45
R9037:Serpinb6b UTSW 13 32978015 nonsense probably null
R9129:Serpinb6b UTSW 13 32978156 small deletion probably benign
R9377:Serpinb6b UTSW 13 32968511 start codon destroyed probably null 1.00
R9415:Serpinb6b UTSW 13 32975019 missense
Predicted Primers PCR Primer
(F):5'- CAACCTGTTTGGAGATTGAGTCAG -3'
(R):5'- TGATCATGGGAGCCTAGGAG -3'

Sequencing Primer
(F):5'- CACCTTGAAAAATGGGCCTGTG -3'
(R):5'- AGCCTAGGAGAGCTGCC -3'
Posted On 2016-10-24