Mutagenetix > Incidental Mutations

Incidental Mutation 'R5541:Tfap2b'

435937

Institutional Source

Beutler Lab

Gene Symbol

Tfap2b

Ensembl Gene

ENSMUSG00000025927

Gene Name

transcription factor AP-2 beta

Synonyms

AP-2(beta), Tcfap2b, E130018K07Rik

MMRRC Submission

043099-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5541 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19208914-19238576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19214026 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 35 (S35G)

Ref Sequence

ENSEMBL: ENSMUSP00000064488 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027059] [ENSMUST00000064976] [ENSMUST00000187754]

AlphaFold

Q61313

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027059
AA Change: S53G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027059
Gene: ENSMUSG00000025927
AA Change: S53G

Domain	Start	End	E-Value	Type
low complexity region	61	83	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
Pfam:TF_AP-2	228	428	7.1e-94	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000064976
AA Change: S35G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064488
Gene: ENSMUSG00000025927
AA Change: S35G

Domain	Start	End	E-Value	Type
low complexity region	43	65	N/A	INTRINSIC
low complexity region	103	114	N/A	INTRINSIC
low complexity region	178	192	N/A	INTRINSIC
Pfam:TF_AP-2	208	415	2.2e-100	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000186972

Predicted Effect

probably benign
Transcript: ENSMUST00000187754
AA Change: S53G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000140213
Gene: ENSMUSG00000025927
AA Change: S53G

Domain	Start	End	E-Value	Type
low complexity region	61	83	N/A	INTRINSIC
low complexity region	121	132	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
Pfam:TF_AP-2	226	433	2.2e-101	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191068

Meta Mutation Damage Score

0.0716

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AP-2 family of transcription factors. AP-2 proteins form homo- or hetero-dimers with other AP-2 family members and bind specific DNA sequences. They are thought to stimulate cell proliferation and suppress terminal differentiation of specific cell types during embryonic development. Specific AP-2 family members differ in their expression patterns and binding affinity for different promoters. This protein functions as both a transcriptional activator and repressor. Mutations in this gene result in autosomal dominant Char syndrome, suggesting that this gene functions in the differentiation of neural crest cell derivatives. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have kidney cysts and show neonatal or postnatal lethality, depending on strain background. On a congenic 129P2 background, mice have tremors, polydactyly, defective tubular secretory function and ion homeostasis, hypocalcemia, hyperphosphatemia, hyperuremia, and terminal renal failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,969	H34R	probably benign	Het
1700113H08Rik	A	G	10: 87,225,946	K86R	probably benign	Het
Abca13	T	C	11: 9,291,545	V1136A	probably benign	Het
Als2cr12	A	G	1: 58,658,429	M384T	probably benign	Het
Arfgap2	G	A	2: 91,275,769	R530H	probably benign	Het
Arhgap30	T	C	1: 171,404,139		probably null	Het
Asb7	T	C	7: 66,679,269	R8G	probably benign	Het
Bod1l	T	C	5: 41,791,933	N2949D	probably benign	Het
Ccdc86	T	C	19: 10,948,554	E227G	probably damaging	Het
Cercam	A	G	2: 29,875,629	D261G	probably benign	Het
Chd9	A	T	8: 91,051,504	E2714D	probably benign	Het
Dcp1a	T	A	14: 30,502,839	S126R	probably damaging	Het
Defa17	T	A	8: 21,656,549	C64S	probably damaging	Het
Depdc5	A	T	5: 32,864,629		probably benign	Het
Dhx29	A	G	13: 112,940,374	N259S	possibly damaging	Het
Dnah6	A	T	6: 73,192,988	L323Q	possibly damaging	Het
Dnah9	T	C	11: 66,145,336	Y416C	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fbxw15	T	G	9: 109,565,430	I106L	probably benign	Het
Gm10610	A	G	7: 83,549,406		noncoding transcript	Het
Gpr22	A	G	12: 31,709,349	F258S	probably damaging	Het
Grip1	A	T	10: 120,072,718	I618F	probably damaging	Het
H2afy2	T	C	10: 61,747,717	I215V	probably benign	Het
Hspg2	C	T	4: 137,520,551	T1233I	probably damaging	Het
Hspg2	C	A	4: 137,542,825	Q2365K	probably benign	Het
Intu	A	G	3: 40,692,587		probably null	Het
Kdm1b	T	C	13: 47,079,196	M714T	probably damaging	Het
Kif21a	A	G	15: 90,968,113	M924T	probably damaging	Het
Klb	A	T	5: 65,379,234	M636L	probably benign	Het
Klrb1a	G	A	6: 128,609,736	H219Y	probably benign	Het
March10	C	T	11: 105,390,131	D443N	probably damaging	Het
Nos1	A	G	5: 117,905,394	E578G	probably damaging	Het
Olfr1502	T	C	19: 13,861,964	I57T	probably benign	Het
Olfr887	T	C	9: 38,085,123	C96R	probably damaging	Het
Pard3b	A	G	1: 61,639,343	Y34C	probably damaging	Het
Pcdh17	T	A	14: 84,447,416	V441E	probably damaging	Het
Pde6g	A	T	11: 120,448,172	I64N	probably damaging	Het
Pdia4	C	T	6: 47,796,637	V593M	probably damaging	Het
Pnn	T	G	12: 59,071,930	V433G	possibly damaging	Het
Rbak	G	A	5: 143,173,990	S436F	probably damaging	Het
Rpl11	A	G	4: 136,052,732		probably benign	Het
Ryr1	G	T	7: 29,086,185	Q1701K	probably damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Smg1	T	A	7: 118,157,163		probably benign	Het
St8sia2	T	C	7: 73,966,900	D109G	probably benign	Het
Stk-ps1	T	A	17: 36,398,213		noncoding transcript	Het
Stxbp3-ps	C	T	19: 9,557,970		noncoding transcript	Het
Taf1d	T	A	9: 15,308,850	F132I	probably damaging	Het
Tnk2	C	T	16: 32,669,523	T198I	probably benign	Het
Ube2q2	T	A	9: 55,191,879	V168E	possibly damaging	Het
Ucma	A	G	2: 4,981,330	R105G	probably benign	Het
Vmn2r97	C	T	17: 18,928,355	Q171*	probably null	Het
Wapl	T	C	14: 34,730,662		probably null	Het
Zfand4	T	A	6: 116,314,295	C397S	possibly damaging	Het
Zfhx3	A	G	8: 108,948,951	N2211S	probably damaging	Het
Zfp143	G	T	7: 110,070,480	G39C	probably benign	Het
Zfp568	T	A	7: 30,022,876	D414E	possibly damaging	Het
Zfp574	C	T	7: 25,081,950	A799V	probably damaging	Het

Other mutations in Tfap2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00504:Tfap2b	APN	1	19214026	missense	possibly damaging	0.94
IGL01868:Tfap2b	APN	1	19214282	missense	probably damaging	0.98
IGL02408:Tfap2b	APN	1	19234261	missense	probably damaging	0.99
IGL02412:Tfap2b	APN	1	19219203	missense	probably damaging	0.99
R0243:Tfap2b	UTSW	1	19234123	missense	probably damaging	1.00
R0552:Tfap2b	UTSW	1	19234225	missense	probably damaging	1.00
R1077:Tfap2b	UTSW	1	19234149	nonsense	probably null
R1541:Tfap2b	UTSW	1	19234070	missense	probably damaging	1.00
R1816:Tfap2b	UTSW	1	19209212	missense	probably damaging	0.98
R2474:Tfap2b	UTSW	1	19214375	missense	possibly damaging	0.49
R5019:Tfap2b	UTSW	1	19226442	missense	probably benign	0.31
R5300:Tfap2b	UTSW	1	19228453	missense	probably damaging	1.00
R5331:Tfap2b	UTSW	1	19226498	missense	probably benign
R5383:Tfap2b	UTSW	1	19226498	missense	probably benign
R5744:Tfap2b	UTSW	1	19219221	missense	probably benign	0.15
R7239:Tfap2b	UTSW	1	19234180	missense	probably damaging	1.00
R7684:Tfap2b	UTSW	1	19214287	missense	probably damaging	1.00
R7686:Tfap2b	UTSW	1	19214287	missense	probably damaging	1.00
R7775:Tfap2b	UTSW	1	19234307	missense	probably damaging	0.98
R7778:Tfap2b	UTSW	1	19234307	missense	probably damaging	0.98
R7824:Tfap2b	UTSW	1	19234307	missense	probably damaging	0.98
R8305:Tfap2b	UTSW	1	19226436	missense	possibly damaging	0.80
R8816:Tfap2b	UTSW	1	19214113	missense	probably benign	0.00
R9040:Tfap2b	UTSW	1	19234090	missense	probably damaging	1.00
R9223:Tfap2b	UTSW	1	19212425	critical splice donor site	probably null
X0026:Tfap2b	UTSW	1	19226550	missense	probably damaging	1.00
Z1176:Tfap2b	UTSW	1	19234133	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- AGAAACCCAACTTCTCTCCTCTC -3'
(R):5'- GAGCCCACTTCTTGGCGTT -3'

Sequencing Primer
(F):5'- ACCCAACTTCTCTCCTCTCTCCTC -3'
(R):5'- GTTGCCGTTGCCCCCAC -3'

Posted On

2016-10-24