Incidental Mutation 'R5541:Tfap2b'
ID435937
Institutional Source Beutler Lab
Gene Symbol Tfap2b
Ensembl Gene ENSMUSG00000025927
Gene Nametranscription factor AP-2 beta
SynonymsAP-2(beta), Tcfap2b, E130018K07Rik
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location19208914-19238576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19214026 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 35 (S35G)
Ref Sequence ENSEMBL: ENSMUSP00000064488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027059] [ENSMUST00000064976] [ENSMUST00000187754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027059
AA Change: S53G

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027059
Gene: ENSMUSG00000025927
AA Change: S53G

DomainStartEndE-ValueType
low complexity region 61 83 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
Pfam:TF_AP-2 228 428 7.1e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000064976
AA Change: S35G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000064488
Gene: ENSMUSG00000025927
AA Change: S35G

DomainStartEndE-ValueType
low complexity region 43 65 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
low complexity region 178 192 N/A INTRINSIC
Pfam:TF_AP-2 208 415 2.2e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186972
Predicted Effect probably benign
Transcript: ENSMUST00000187754
AA Change: S53G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000140213
Gene: ENSMUSG00000025927
AA Change: S53G

DomainStartEndE-ValueType
low complexity region 61 83 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
Pfam:TF_AP-2 226 433 2.2e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191068
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AP-2 family of transcription factors. AP-2 proteins form homo- or hetero-dimers with other AP-2 family members and bind specific DNA sequences. They are thought to stimulate cell proliferation and suppress terminal differentiation of specific cell types during embryonic development. Specific AP-2 family members differ in their expression patterns and binding affinity for different promoters. This protein functions as both a transcriptional activator and repressor. Mutations in this gene result in autosomal dominant Char syndrome, suggesting that this gene functions in the differentiation of neural crest cell derivatives. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes have kidney cysts and show neonatal or postnatal lethality, depending on strain background. On a congenic 129P2 background, mice have tremors, polydactyly, defective tubular secretory function and ion homeostasis, hypocalcemia, hyperphosphatemia, hyperuremia, and terminal renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Tfap2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Tfap2b APN 1 19214026 missense possibly damaging 0.94
IGL01868:Tfap2b APN 1 19214282 missense probably damaging 0.98
IGL02408:Tfap2b APN 1 19234261 missense probably damaging 0.99
IGL02412:Tfap2b APN 1 19219203 missense probably damaging 0.99
R0243:Tfap2b UTSW 1 19234123 missense probably damaging 1.00
R0552:Tfap2b UTSW 1 19234225 missense probably damaging 1.00
R1077:Tfap2b UTSW 1 19234149 nonsense probably null
R1541:Tfap2b UTSW 1 19234070 missense probably damaging 1.00
R1816:Tfap2b UTSW 1 19209212 missense probably damaging 0.98
R2474:Tfap2b UTSW 1 19214375 missense possibly damaging 0.49
R5019:Tfap2b UTSW 1 19226442 missense probably benign 0.31
R5300:Tfap2b UTSW 1 19228453 missense probably damaging 1.00
R5331:Tfap2b UTSW 1 19226498 missense probably benign
R5383:Tfap2b UTSW 1 19226498 missense probably benign
R5744:Tfap2b UTSW 1 19219221 missense probably benign 0.15
R7239:Tfap2b UTSW 1 19234180 missense probably damaging 1.00
R7684:Tfap2b UTSW 1 19214287 missense probably damaging 1.00
R7686:Tfap2b UTSW 1 19214287 missense probably damaging 1.00
R7775:Tfap2b UTSW 1 19234307 missense probably damaging 0.98
R7778:Tfap2b UTSW 1 19234307 missense probably damaging 0.98
R7824:Tfap2b UTSW 1 19234307 missense probably damaging 0.98
R8305:Tfap2b UTSW 1 19226436 missense possibly damaging 0.80
X0026:Tfap2b UTSW 1 19226550 missense probably damaging 1.00
Z1176:Tfap2b UTSW 1 19234133 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGAAACCCAACTTCTCTCCTCTC -3'
(R):5'- GAGCCCACTTCTTGGCGTT -3'

Sequencing Primer
(F):5'- ACCCAACTTCTCTCCTCTCTCCTC -3'
(R):5'- GTTGCCGTTGCCCCCAC -3'
Posted On2016-10-24