Incidental Mutation 'R5541:Arhgap30'
ID435939
Institutional Source Beutler Lab
Gene Symbol Arhgap30
Ensembl Gene ENSMUSG00000048865
Gene NameRho GTPase activating protein 30
Synonyms6030405P05Rik
MMRRC Submission 043099-MU
Accession Numbers

Ncbi RefSeq: NM_001005508.2; MGI: 2684948

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location171388954-171410298 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 171404139 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000059389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056449]
Predicted Effect probably null
Transcript: ENSMUST00000056449
SMART Domains Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
RhoGAP 31 212 1.4e-61 SMART
Blast:RhoGAP 225 285 2e-24 BLAST
low complexity region 348 366 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
low complexity region 498 510 N/A INTRINSIC
low complexity region 514 534 N/A INTRINSIC
low complexity region 667 690 N/A INTRINSIC
low complexity region 736 752 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135312
Meta Mutation Damage Score 0.9592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Arhgap30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Arhgap30 APN 1 171397570 missense probably damaging 1.00
IGL02016:Arhgap30 APN 1 171407747 missense probably damaging 1.00
IGL02552:Arhgap30 APN 1 171407756 missense probably damaging 1.00
IGL03343:Arhgap30 APN 1 171409094 missense probably damaging 1.00
consonance UTSW 1 171404139 critical splice donor site probably null
deliverance UTSW 1 171397518 nonsense probably null
redemption UTSW 1 171402254 missense probably damaging 1.00
tercero UTSW 1 171408341 missense probably benign
FR4304:Arhgap30 UTSW 1 171405168 small insertion probably benign
P0017:Arhgap30 UTSW 1 171408704 missense probably benign 0.02
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0115:Arhgap30 UTSW 1 171407948 missense possibly damaging 0.92
R0320:Arhgap30 UTSW 1 171403804 missense possibly damaging 0.81
R0399:Arhgap30 UTSW 1 171404816 missense probably damaging 0.97
R0945:Arhgap30 UTSW 1 171403286 missense probably damaging 1.00
R1484:Arhgap30 UTSW 1 171403271 missense probably damaging 1.00
R1595:Arhgap30 UTSW 1 171408341 missense probably benign
R2173:Arhgap30 UTSW 1 171407767 missense probably damaging 1.00
R2281:Arhgap30 UTSW 1 171389328 missense probably damaging 1.00
R2864:Arhgap30 UTSW 1 171408206 missense probably damaging 1.00
R4066:Arhgap30 UTSW 1 171408323 missense probably benign
R4888:Arhgap30 UTSW 1 171409312 missense probably benign
R4937:Arhgap30 UTSW 1 171403329 missense probably benign 0.03
R4944:Arhgap30 UTSW 1 171402254 missense probably damaging 1.00
R5170:Arhgap30 UTSW 1 171408050 missense probably benign 0.00
R5218:Arhgap30 UTSW 1 171408760 missense probably benign
R5385:Arhgap30 UTSW 1 171408280 missense probably benign
R6028:Arhgap30 UTSW 1 171408320 missense probably benign
R6747:Arhgap30 UTSW 1 171407729 missense probably damaging 1.00
R6748:Arhgap30 UTSW 1 171404810 missense possibly damaging 0.50
R6869:Arhgap30 UTSW 1 171409055 missense probably damaging 1.00
R7223:Arhgap30 UTSW 1 171407571 missense probably damaging 1.00
R8113:Arhgap30 UTSW 1 171397518 nonsense probably null
R8543:Arhgap30 UTSW 1 171404962 missense probably damaging 1.00
R8545:Arhgap30 UTSW 1 171407430 missense probably damaging 1.00
X0020:Arhgap30 UTSW 1 171405085 missense possibly damaging 0.53
Z1177:Arhgap30 UTSW 1 171407908 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGTAAGGTCTCCTTCCTGG -3'
(R):5'- GCTGTTGTCACTGCACATACAC -3'

Sequencing Primer
(F):5'- AGTAAGGTCTCCTTCCTGGGACTC -3'
(R):5'- TGTTGTCACTGCACATACACATACAC -3'
Posted On2016-10-24