Incidental Mutation 'R5541:Ucma'
ID435940
Institutional Source Beutler Lab
Gene Symbol Ucma
Ensembl Gene ENSMUSG00000026668
Gene Nameupper zone of growth plate and cartilage matrix associated
Synonyms
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location4976122-4985748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4981330 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 105 (R105G)
Ref Sequence ENSEMBL: ENSMUSP00000110662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027978] [ENSMUST00000115010] [ENSMUST00000167607] [ENSMUST00000195688]
Predicted Effect probably benign
Transcript: ENSMUST00000027978
AA Change: R83G

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027978
Gene: ENSMUSG00000026668
AA Change: R83G

DomainStartEndE-ValueType
Pfam:Selenoprotein_S 6 112 5.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115010
AA Change: R105G

PolyPhen 2 Score 0.252 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110662
Gene: ENSMUSG00000026668
AA Change: R105G

DomainStartEndE-ValueType
Pfam:UCMA 1 134 2.9e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127282
Predicted Effect probably benign
Transcript: ENSMUST00000167607
SMART Domains Protein: ENSMUSP00000126371
Gene: ENSMUSG00000026668

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195688
SMART Domains Protein: ENSMUSP00000141304
Gene: ENSMUSG00000026668

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: This gene encodes chondrocyte-specific, highly charged proteins that are abundantly expressed during the early stages of chondrogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein that is secreted into the extracellular matrix. The glutamic acid residues in the encoded protein undergo gamma carboxylation in a vitamin K-dependent manner. Despite the implied role in calcification and ossification, mice lacking the encoded protein do not display significant defects in the skeletal development. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo a similar proteolytic processing to generate mature proteins. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skeleton phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Ucma
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01316:Ucma APN 2 4981231 intron probably benign
IGL02412:Ucma APN 2 4976825 missense probably damaging 1.00
R4672:Ucma UTSW 2 4976654 critical splice acceptor site probably null
R7406:Ucma UTSW 2 4985359 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCAGCAAAACCCGTGACC -3'
(R):5'- ACAACATCTTAAGTCTGCATAGCC -3'

Sequencing Primer
(F):5'- TTCACCAGGTCTAGCTTCTCAGG -3'
(R):5'- AAGTCTGCATAGCCATTTTTGTG -3'
Posted On2016-10-24