Incidental Mutation 'R5541:Cercam'
ID435941
Institutional Source Beutler Lab
Gene Symbol Cercam
Ensembl Gene ENSMUSG00000039787
Gene Namecerebral endothelial cell adhesion molecule
SynonymsCeecam1, CerCAM
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location29869164-29882840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29875629 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 261 (D261G)
Ref Sequence ENSEMBL: ENSMUSP00000041622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047521] [ENSMUST00000134152] [ENSMUST00000154464]
Predicted Effect probably benign
Transcript: ENSMUST00000047521
AA Change: D261G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041622
Gene: ENSMUSG00000039787
AA Change: D261G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 37 157 2.6e-15 PFAM
Pfam:Glyco_transf_25 316 500 3.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134152
SMART Domains Protein: ENSMUSP00000115902
Gene: ENSMUSG00000039787

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153863
Predicted Effect probably benign
Transcript: ENSMUST00000154464
SMART Domains Protein: ENSMUSP00000119476
Gene: ENSMUSG00000039787

DomainStartEndE-ValueType
low complexity region 11 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155355
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Cercam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01885:Cercam APN 2 29881003 missense probably damaging 1.00
IGL02619:Cercam APN 2 29880674 missense probably benign 0.05
IGL03088:Cercam APN 2 29881687 splice site probably benign
I1329:Cercam UTSW 2 29871085 missense probably damaging 1.00
P0042:Cercam UTSW 2 29881083 missense probably damaging 1.00
R0086:Cercam UTSW 2 29871064 missense probably damaging 1.00
R0829:Cercam UTSW 2 29871067 missense probably damaging 0.98
R1442:Cercam UTSW 2 29880640 missense probably benign
R1558:Cercam UTSW 2 29876239 missense probably benign 0.35
R1997:Cercam UTSW 2 29872923 missense probably benign 0.11
R4678:Cercam UTSW 2 29869677 missense probably damaging 1.00
R4889:Cercam UTSW 2 29881833 missense probably damaging 0.96
R4891:Cercam UTSW 2 29869271 unclassified probably benign
R4967:Cercam UTSW 2 29871021 critical splice acceptor site probably null
R5052:Cercam UTSW 2 29875627 missense probably damaging 1.00
R5650:Cercam UTSW 2 29881815 missense probably damaging 1.00
R7072:Cercam UTSW 2 29881924 missense probably benign 0.00
R7422:Cercam UTSW 2 29872880 missense possibly damaging 0.81
R7585:Cercam UTSW 2 29881731 missense probably damaging 1.00
R7725:Cercam UTSW 2 29872562 critical splice acceptor site probably null
R7730:Cercam UTSW 2 29872562 critical splice acceptor site probably null
R7747:Cercam UTSW 2 29871286 missense probably benign 0.02
RF016:Cercam UTSW 2 29869305 missense unknown
Predicted Primers PCR Primer
(F):5'- ACCATGATGAGGTGCTGGTG -3'
(R):5'- AAGGCTGGCATGCAAATATG -3'

Sequencing Primer
(F):5'- AAGTTCAGCCCAGTGCCCTAG -3'
(R):5'- GTGCTTCCAAAATGAGGTG -3'
Posted On2016-10-24