Mutagenetix > Incidental Mutations

Incidental Mutation 'R5541:Intu'

435945

Institutional Source

Beutler Lab

Gene Symbol

Intu

Ensembl Gene

ENSMUSG00000060798

Gene Name

inturned planar cell polarity protein

Synonyms

Pdzd6, Pdzk6, 9430087H23Rik, 9230116I04Rik

MMRRC Submission

043099-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5541 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

40531286-40704774 bp(+) (GRCm38)

Type of Mutation

splice site (63 bp from exon)

DNA Base Change (assembly)

A to G at 40692587 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091186]

AlphaFold

Q059U7

Predicted Effect

probably damaging
Transcript: ENSMUST00000091186
AA Change: D630G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: D630G

Domain	Start	End	E-Value	Type
low complexity region	21	48	N/A	INTRINSIC
low complexity region	64	81	N/A	INTRINSIC
PDZ	187	269	2.09e-3	SMART
low complexity region	459	468	N/A	INTRINSIC
low complexity region	774	784	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000204176

Meta Mutation Damage Score

0.5143

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,969	H34R	probably benign	Het
1700113H08Rik	A	G	10: 87,225,946	K86R	probably benign	Het
Abca13	T	C	11: 9,291,545	V1136A	probably benign	Het
Als2cr12	A	G	1: 58,658,429	M384T	probably benign	Het
Arfgap2	G	A	2: 91,275,769	R530H	probably benign	Het
Arhgap30	T	C	1: 171,404,139		probably null	Het
Asb7	T	C	7: 66,679,269	R8G	probably benign	Het
Bod1l	T	C	5: 41,791,933	N2949D	probably benign	Het
Ccdc86	T	C	19: 10,948,554	E227G	probably damaging	Het
Cercam	A	G	2: 29,875,629	D261G	probably benign	Het
Chd9	A	T	8: 91,051,504	E2714D	probably benign	Het
Dcp1a	T	A	14: 30,502,839	S126R	probably damaging	Het
Defa17	T	A	8: 21,656,549	C64S	probably damaging	Het
Depdc5	A	T	5: 32,864,629		probably benign	Het
Dhx29	A	G	13: 112,940,374	N259S	possibly damaging	Het
Dnah6	A	T	6: 73,192,988	L323Q	possibly damaging	Het
Dnah9	T	C	11: 66,145,336	Y416C	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fbxw15	T	G	9: 109,565,430	I106L	probably benign	Het
Gm10610	A	G	7: 83,549,406		noncoding transcript	Het
Gpr22	A	G	12: 31,709,349	F258S	probably damaging	Het
Grip1	A	T	10: 120,072,718	I618F	probably damaging	Het
H2afy2	T	C	10: 61,747,717	I215V	probably benign	Het
Hspg2	C	T	4: 137,520,551	T1233I	probably damaging	Het
Hspg2	C	A	4: 137,542,825	Q2365K	probably benign	Het
Kdm1b	T	C	13: 47,079,196	M714T	probably damaging	Het
Kif21a	A	G	15: 90,968,113	M924T	probably damaging	Het
Klb	A	T	5: 65,379,234	M636L	probably benign	Het
Klrb1a	G	A	6: 128,609,736	H219Y	probably benign	Het
March10	C	T	11: 105,390,131	D443N	probably damaging	Het
Nos1	A	G	5: 117,905,394	E578G	probably damaging	Het
Olfr1502	T	C	19: 13,861,964	I57T	probably benign	Het
Olfr887	T	C	9: 38,085,123	C96R	probably damaging	Het
Pard3b	A	G	1: 61,639,343	Y34C	probably damaging	Het
Pcdh17	T	A	14: 84,447,416	V441E	probably damaging	Het
Pde6g	A	T	11: 120,448,172	I64N	probably damaging	Het
Pdia4	C	T	6: 47,796,637	V593M	probably damaging	Het
Pnn	T	G	12: 59,071,930	V433G	possibly damaging	Het
Rbak	G	A	5: 143,173,990	S436F	probably damaging	Het
Rpl11	A	G	4: 136,052,732		probably benign	Het
Ryr1	G	T	7: 29,086,185	Q1701K	probably damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Smg1	T	A	7: 118,157,163		probably benign	Het
St8sia2	T	C	7: 73,966,900	D109G	probably benign	Het
Stk-ps1	T	A	17: 36,398,213		noncoding transcript	Het
Stxbp3-ps	C	T	19: 9,557,970		noncoding transcript	Het
Taf1d	T	A	9: 15,308,850	F132I	probably damaging	Het
Tfap2b	A	G	1: 19,214,026	S35G	possibly damaging	Het
Tnk2	C	T	16: 32,669,523	T198I	probably benign	Het
Ube2q2	T	A	9: 55,191,879	V168E	possibly damaging	Het
Ucma	A	G	2: 4,981,330	R105G	probably benign	Het
Vmn2r97	C	T	17: 18,928,355	Q171*	probably null	Het
Wapl	T	C	14: 34,730,662		probably null	Het
Zfand4	T	A	6: 116,314,295	C397S	possibly damaging	Het
Zfhx3	A	G	8: 108,948,951	N2211S	probably damaging	Het
Zfp143	G	T	7: 110,070,480	G39C	probably benign	Het
Zfp568	T	A	7: 30,022,876	D414E	possibly damaging	Het
Zfp574	C	T	7: 25,081,950	A799V	probably damaging	Het

Other mutations in Intu

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01292:Intu	APN	3	40664266	missense	probably benign	0.12
IGL01386:Intu	APN	3	40692587	missense	probably damaging	1.00
IGL02645:Intu	APN	3	40701272	missense	probably benign	0.01
IGL02869:Intu	APN	3	40687786	missense	probably damaging	1.00
IGL03263:Intu	APN	3	40672597	nonsense	probably null
H8562:Intu	UTSW	3	40692673	missense	probably damaging	1.00
PIT4495001:Intu	UTSW	3	40697603	missense	probably benign	0.07
R0010:Intu	UTSW	3	40654272	intron	probably benign
R0173:Intu	UTSW	3	40675346	critical splice donor site	probably null
R0426:Intu	UTSW	3	40675305	missense	probably damaging	0.97
R1566:Intu	UTSW	3	40692578	missense	probably damaging	0.99
R1619:Intu	UTSW	3	40697631	nonsense	probably null
R1658:Intu	UTSW	3	40692781	missense	probably benign	0.20
R1701:Intu	UTSW	3	40664264	missense	probably damaging	1.00
R1707:Intu	UTSW	3	40540924	missense	probably benign	0.03
R1707:Intu	UTSW	3	40683501	missense	possibly damaging	0.69
R1867:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R1868:Intu	UTSW	3	40664335	missense	probably damaging	1.00
R2090:Intu	UTSW	3	40683536	missense	probably benign	0.00
R2310:Intu	UTSW	3	40653813	missense	probably benign
R2989:Intu	UTSW	3	40692710	missense	probably benign	0.11
R4168:Intu	UTSW	3	40672623	missense	probably benign	0.00
R4530:Intu	UTSW	3	40683364	missense	possibly damaging	0.95
R5093:Intu	UTSW	3	40692917	missense	probably benign	0.00
R5587:Intu	UTSW	3	40675308	missense	probably damaging	0.99
R5745:Intu	UTSW	3	40692972	splice site	probably null
R5809:Intu	UTSW	3	40679590	missense	probably damaging	0.99
R5939:Intu	UTSW	3	40692584	missense	probably damaging	1.00
R5953:Intu	UTSW	3	40679550	missense	probably damaging	1.00
R6000:Intu	UTSW	3	40654148	nonsense	probably null
R6063:Intu	UTSW	3	40654094	missense	probably damaging	0.97
R6245:Intu	UTSW	3	40675326	missense	probably damaging	0.98
R6310:Intu	UTSW	3	40701291	nonsense	probably null
R6353:Intu	UTSW	3	40653708	missense	probably damaging	1.00
R6451:Intu	UTSW	3	40701293	missense	possibly damaging	0.94
R6660:Intu	UTSW	3	40531951	missense	probably benign	0.00
R6848:Intu	UTSW	3	40694255	missense	probably benign	0.00
R7440:Intu	UTSW	3	40697551	missense	probably benign	0.04
R7625:Intu	UTSW	3	40697599	missense	probably benign
R7633:Intu	UTSW	3	40654253	missense	probably damaging	1.00
R7798:Intu	UTSW	3	40691929	missense	probably damaging	1.00
R7877:Intu	UTSW	3	40699792	missense	probably benign	0.07
R7978:Intu	UTSW	3	40697639	missense	probably damaging	1.00
R8319:Intu	UTSW	3	40653772	missense	probably damaging	1.00
R8332:Intu	UTSW	3	40675289	missense	probably benign	0.35
R8860:Intu	UTSW	3	40672732	missense	probably benign	0.07
R8926:Intu	UTSW	3	40653709	missense	possibly damaging	0.69
R8946:Intu	UTSW	3	40683359	missense	possibly damaging	0.93
R9164:Intu	UTSW	3	40690703	missense	probably damaging	1.00
R9191:Intu	UTSW	3	40692511	missense	probably damaging	0.99
Z1177:Intu	UTSW	3	40697516	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- GATTGAGAGATTTTCAGAACTCACGAG -3'
(R):5'- AAGGTTCTCCTGCATGTTGG -3'

Sequencing Primer
(F):5'- TTTCAGAACTCACGAGTATTTGC -3'
(R):5'- CTGCTGTTTTGGAAGGCCCC -3'

Posted On

2016-10-24