Incidental Mutation 'R5541:Rpl11'
ID435947
Institutional Source Beutler Lab
Gene Symbol Rpl11
Ensembl Gene ENSMUSG00000059291
Gene Nameribosomal protein L11
Synonyms
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R5541 (G1)
Quality Score147
Status Validated
Chromosome4
Chromosomal Location136028265-136053428 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 136052732 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102536] [ENSMUST00000155873]
Predicted Effect probably benign
Transcript: ENSMUST00000102536
SMART Domains Protein: ENSMUSP00000099595
Gene: ENSMUSG00000059291

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 10 63 6.9e-23 PFAM
Pfam:Ribosomal_L5_C 67 166 9.5e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128733
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142440
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150565
Predicted Effect probably benign
Transcript: ENSMUST00000155873
SMART Domains Protein: ENSMUSP00000121108
Gene: ENSMUSG00000059291

DomainStartEndE-ValueType
Pfam:Ribosomal_L5 13 66 8e-23 PFAM
Pfam:Ribosomal_L5_C 70 169 1.1e-26 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L5P family of ribosomal proteins. It is located in the cytoplasm. The protein probably associates with the 5S rRNA. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Rpl11
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4373:Rpl11 UTSW 4 136051143 intron probably benign
R4374:Rpl11 UTSW 4 136051143 intron probably benign
R4375:Rpl11 UTSW 4 136051143 intron probably benign
R4377:Rpl11 UTSW 4 136051143 intron probably benign
R4560:Rpl11 UTSW 4 136051211 missense probably damaging 1.00
R4781:Rpl11 UTSW 4 136050288 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCAGATGAAGCAAGCTTTCC -3'
(R):5'- AGTGTCTGTTCCCTACTCGTGG -3'

Sequencing Primer
(F):5'- GTCAGATGAAGCAAGCTTTCCAGATC -3'
(R):5'- CTACTCGTGGATCCGCTTGG -3'
Posted On2016-10-24