Incidental Mutation 'R5541:Depdc5'
ID435950
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene NameDEP domain containing 5
Synonyms
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32863701-32994236 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to T at 32864629 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000118698] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000125574] [ENSMUST00000149350] [ENSMUST00000150130] [ENSMUST00000195980] [ENSMUST00000202927]
Predicted Effect probably benign
Transcript: ENSMUST00000049780
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087897
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118698
SMART Domains Protein: ENSMUSP00000112906
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 205 1.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119705
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120902
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125574
SMART Domains Protein: ENSMUSP00000122173
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 137 6.9e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139463
Predicted Effect probably benign
Transcript: ENSMUST00000149350
SMART Domains Protein: ENSMUSP00000122461
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 161 1.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150130
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201802
Predicted Effect probably benign
Transcript: ENSMUST00000202927
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
IGL02988:Depdc5 UTSW 5 32956167 utr 3 prime probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2851:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 intron probably null
R2938:Depdc5 UTSW 5 32901621 intron probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4738:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6132:Depdc5 UTSW 5 32910467 missense probably damaging 0.99
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 unclassified probably null
R6468:Depdc5 UTSW 5 32912231 missense probably benign 0.02
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
R7002:Depdc5 UTSW 5 32877158 splice site probably null
R7066:Depdc5 UTSW 5 32901848 missense probably benign 0.08
R7231:Depdc5 UTSW 5 32901865 missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 32967745 missense probably benign
R7302:Depdc5 UTSW 5 32979508 missense probably damaging 1.00
R7386:Depdc5 UTSW 5 32927936 missense probably benign
R7564:Depdc5 UTSW 5 32901510 missense probably damaging 1.00
R7636:Depdc5 UTSW 5 32917983 missense probably benign
R7795:Depdc5 UTSW 5 32944103 missense probably damaging 1.00
R7928:Depdc5 UTSW 5 32903915 splice site probably null
R8013:Depdc5 UTSW 5 32973842 missense probably benign 0.01
R8037:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8038:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8065:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 32943282 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- AGATCTGAGCCCAAGTTCCC -3'
(R):5'- AACCATCCCTGATCTCTGATACTG -3'

Sequencing Primer
(F):5'- CTCTCTTGGTAATTGGAGGAGC -3'
(R):5'- CTGATCTCTGATACTGCTCCAC -3'
Posted On2016-10-24