Mutagenetix > Incidental Mutations

Incidental Mutation 'R5541:Klb'

435952

Institutional Source

Beutler Lab

Gene Symbol

Klb

Ensembl Gene

ENSMUSG00000029195

Gene Name

klotho beta

Synonyms

betaKlotho

MMRRC Submission

043099-MU

Accession Numbers

Genbank: NM_031180.2; Ensembl: ENSMUST00000031096;

MGI:1932466

Is this an essential gene?

Probably essential (E-score: 0.898) question?

Stock #

R5541 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

65348314-65384007 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 65379234 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 636 (M636L)

Ref Sequence

ENSEMBL: ENSMUSP00000031096 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031096] [ENSMUST00000205084]

AlphaFold

Q99N32

Predicted Effect

probably benign
Transcript: ENSMUST00000031096
AA Change: M636L

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000031096
Gene: ENSMUSG00000029195
AA Change: M636L

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	77	385	8.8e-96	PFAM
Pfam:Glyco_hydro_1	374	506	1.7e-31	PFAM
Pfam:Glyco_hydro_1	515	965	6.3e-80	PFAM
transmembrane domain	995	1017	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000205084

SMART Domains

Protein: ENSMUSP00000145091
Gene: ENSMUSG00000029195

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_1	77	360	8.6e-94	PFAM

Meta Mutation Damage Score

0.3077

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

Strain: 3587748
PHENOTYPE: Homozygous null mice display increased bile acid synthesis and excretion, resistance to gallstone formation, and slightly decreased body weight. Mice homozygous for a knock-out allele or a conditional allele activated in adipose tissue exhibit resistanceto FGF21-induced metabolic disruptions. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(2) Gene trapped(3)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,969	H34R	probably benign	Het
1700113H08Rik	A	G	10: 87,225,946	K86R	probably benign	Het
Abca13	T	C	11: 9,291,545	V1136A	probably benign	Het
Als2cr12	A	G	1: 58,658,429	M384T	probably benign	Het
Arfgap2	G	A	2: 91,275,769	R530H	probably benign	Het
Arhgap30	T	C	1: 171,404,139		probably null	Het
Asb7	T	C	7: 66,679,269	R8G	probably benign	Het
Bod1l	T	C	5: 41,791,933	N2949D	probably benign	Het
Ccdc86	T	C	19: 10,948,554	E227G	probably damaging	Het
Cercam	A	G	2: 29,875,629	D261G	probably benign	Het
Chd9	A	T	8: 91,051,504	E2714D	probably benign	Het
Dcp1a	T	A	14: 30,502,839	S126R	probably damaging	Het
Defa17	T	A	8: 21,656,549	C64S	probably damaging	Het
Depdc5	A	T	5: 32,864,629		probably benign	Het
Dhx29	A	G	13: 112,940,374	N259S	possibly damaging	Het
Dnah6	A	T	6: 73,192,988	L323Q	possibly damaging	Het
Dnah9	T	C	11: 66,145,336	Y416C	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fbxw15	T	G	9: 109,565,430	I106L	probably benign	Het
Gm10610	A	G	7: 83,549,406		noncoding transcript	Het
Gpr22	A	G	12: 31,709,349	F258S	probably damaging	Het
Grip1	A	T	10: 120,072,718	I618F	probably damaging	Het
H2afy2	T	C	10: 61,747,717	I215V	probably benign	Het
Hspg2	C	T	4: 137,520,551	T1233I	probably damaging	Het
Hspg2	C	A	4: 137,542,825	Q2365K	probably benign	Het
Intu	A	G	3: 40,692,587		probably null	Het
Kdm1b	T	C	13: 47,079,196	M714T	probably damaging	Het
Kif21a	A	G	15: 90,968,113	M924T	probably damaging	Het
Klrb1a	G	A	6: 128,609,736	H219Y	probably benign	Het
March10	C	T	11: 105,390,131	D443N	probably damaging	Het
Nos1	A	G	5: 117,905,394	E578G	probably damaging	Het
Olfr1502	T	C	19: 13,861,964	I57T	probably benign	Het
Olfr887	T	C	9: 38,085,123	C96R	probably damaging	Het
Pard3b	A	G	1: 61,639,343	Y34C	probably damaging	Het
Pcdh17	T	A	14: 84,447,416	V441E	probably damaging	Het
Pde6g	A	T	11: 120,448,172	I64N	probably damaging	Het
Pdia4	C	T	6: 47,796,637	V593M	probably damaging	Het
Pnn	T	G	12: 59,071,930	V433G	possibly damaging	Het
Rbak	G	A	5: 143,173,990	S436F	probably damaging	Het
Rpl11	A	G	4: 136,052,732		probably benign	Het
Ryr1	G	T	7: 29,086,185	Q1701K	probably damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Smg1	T	A	7: 118,157,163		probably benign	Het
St8sia2	T	C	7: 73,966,900	D109G	probably benign	Het
Stk-ps1	T	A	17: 36,398,213		noncoding transcript	Het
Stxbp3-ps	C	T	19: 9,557,970		noncoding transcript	Het
Taf1d	T	A	9: 15,308,850	F132I	probably damaging	Het
Tfap2b	A	G	1: 19,214,026	S35G	possibly damaging	Het
Tnk2	C	T	16: 32,669,523	T198I	probably benign	Het
Ube2q2	T	A	9: 55,191,879	V168E	possibly damaging	Het
Ucma	A	G	2: 4,981,330	R105G	probably benign	Het
Vmn2r97	C	T	17: 18,928,355	Q171*	probably null	Het
Wapl	T	C	14: 34,730,662		probably null	Het
Zfand4	T	A	6: 116,314,295	C397S	possibly damaging	Het
Zfhx3	A	G	8: 108,948,951	N2211S	probably damaging	Het
Zfp143	G	T	7: 110,070,480	G39C	probably benign	Het
Zfp568	T	A	7: 30,022,876	D414E	possibly damaging	Het
Zfp574	C	T	7: 25,081,950	A799V	probably damaging	Het

Other mutations in Klb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Klb	APN	5	65372374	missense	possibly damaging	0.90
IGL00821:Klb	APN	5	65372149	missense	probably damaging	1.00
IGL01082:Klb	APN	5	65375940	missense	possibly damaging	0.71
IGL01637:Klb	APN	5	65375679	critical splice acceptor site	probably null
IGL02098:Klb	APN	5	65379885	missense	probably benign	0.21
IGL03113:Klb	APN	5	65383470	missense	probably benign	0.00
1mM(1):Klb	UTSW	5	65348650	missense	probably damaging	1.00
P0016:Klb	UTSW	5	65379923	nonsense	probably null
R0268:Klb	UTSW	5	65348837	missense	probably benign	0.02
R0383:Klb	UTSW	5	65372499	splice site	probably null
R0676:Klb	UTSW	5	65379055	missense	probably damaging	1.00
R0735:Klb	UTSW	5	65379727	missense	probably benign
R0972:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1051:Klb	UTSW	5	65379327	missense	probably damaging	1.00
R1168:Klb	UTSW	5	65378974	missense	probably damaging	1.00
R1372:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1403:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1403:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1446:Klb	UTSW	5	65348995	missense	probably damaging	1.00
R1696:Klb	UTSW	5	65348746	missense	possibly damaging	0.70
R1743:Klb	UTSW	5	65375861	missense	probably damaging	0.99
R1801:Klb	UTSW	5	65349235	missense	probably null	0.90
R1804:Klb	UTSW	5	65379853	missense	probably damaging	1.00
R1848:Klb	UTSW	5	65348837	missense	probably benign	0.02
R1967:Klb	UTSW	5	65372074	missense	probably damaging	0.98
R3420:Klb	UTSW	5	65372142	missense	probably damaging	1.00
R4397:Klb	UTSW	5	65380039	missense	probably damaging	1.00
R4490:Klb	UTSW	5	65375794	missense	probably benign	0.02
R4491:Klb	UTSW	5	65375794	missense	probably benign	0.02
R4547:Klb	UTSW	5	65379928	missense	probably benign	0.00
R4878:Klb	UTSW	5	65348490	missense	probably damaging	0.99
R5269:Klb	UTSW	5	65348797	missense	probably damaging	1.00
R5418:Klb	UTSW	5	65383470	missense	probably benign	0.00
R5453:Klb	UTSW	5	65383385	missense	probably benign	0.08
R5672:Klb	UTSW	5	65379949	missense	possibly damaging	0.82
R5841:Klb	UTSW	5	65379324	nonsense	probably null
R6088:Klb	UTSW	5	65349013	missense	probably benign	0.07
R6807:Klb	UTSW	5	65379534	missense	probably damaging	1.00
R6955:Klb	UTSW	5	65379088	nonsense	probably null
R7068:Klb	UTSW	5	65379340	missense	probably damaging	1.00
R7284:Klb	UTSW	5	65383478	missense	probably benign	0.01
R7322:Klb	UTSW	5	65383364	missense	probably benign	0.44
R7346:Klb	UTSW	5	65348631	nonsense	probably null
R7366:Klb	UTSW	5	65372431	missense	probably damaging	1.00
R8134:Klb	UTSW	5	65383615	missense	probably benign	0.00
R8243:Klb	UTSW	5	65378995	missense	possibly damaging	0.65
R8409:Klb	UTSW	5	65379535	missense	probably damaging	0.96
R8971:Klb	UTSW	5	65375683	missense	probably damaging	1.00
R9193:Klb	UTSW	5	65372025	missense	possibly damaging	0.63
R9305:Klb	UTSW	5	65348645	nonsense	probably null
R9390:Klb	UTSW	5	65375701	missense	possibly damaging	0.50
Z1177:Klb	UTSW	5	65348741	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATCCCAGTGCACAGATTATG -3'
(R):5'- TACTCGTGCGGTTGTACATG -3'

Sequencing Primer
(F):5'- TTCCCACTGGCAATCTGT -3'
(R):5'- GTACATGTCACTCAGCCTGTTAGG -3'

Posted On

2016-10-24