Incidental Mutation 'R5541:St8sia2'
ID435962
Institutional Source Beutler Lab
Gene Symbol St8sia2
Ensembl Gene ENSMUSG00000025789
Gene NameST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2
SynonymsSiat8b, ST8SiaII
MMRRC Submission 043099-MU
Accession Numbers

Ncbi RefSeq: NM_009181.2; MGI:106020

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location73939119-74013690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73966900 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 109 (D109G)
Ref Sequence ENSEMBL: ENSMUSP00000141307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026896] [ENSMUST00000191970]
Predicted Effect probably benign
Transcript: ENSMUST00000026896
AA Change: D130G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026896
Gene: ENSMUSG00000025789
AA Change: D130G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glyco_transf_29 109 369 2.7e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191970
AA Change: D109G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141307
Gene: ENSMUSG00000025789
AA Change: D109G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
Pfam:Glyco_transf_29 84 206 5.8e-36 PFAM
Meta Mutation Damage Score 0.1217 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype Strain: 3051219
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that is thought to catalyze the transfer of sialic acid from CMP-sialic acid to N-linked oligosaccharides and glycoproteins. The encoded protein may be found in the Golgi apparatus and may be involved in the production of polysialic acid, a modulator of the adhesive properties of neural cell adhesion molecule (NCAM1). This protein is a member of glycosyltransferase family 29. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal mossy fiber morphology, increased exploration in new environment and impaired fear responses. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in St8sia2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02161:St8sia2 APN 7 73976682 missense probably benign 0.00
IGL02261:St8sia2 APN 7 73966846 missense probably damaging 1.00
IGL02941:St8sia2 APN 7 73976649 intron probably benign
IGL02971:St8sia2 APN 7 73966811 missense probably damaging 1.00
IGL03147:St8sia2 UTSW 7 73966819 missense probably damaging 1.00
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73943290 nonsense probably null
R0052:St8sia2 UTSW 7 73971952 missense probably damaging 1.00
R0733:St8sia2 UTSW 7 73960840 missense probably benign
R1202:St8sia2 UTSW 7 73972035 missense probably benign 0.43
R1419:St8sia2 UTSW 7 73966994 nonsense probably null
R1962:St8sia2 UTSW 7 73943309 missense probably damaging 1.00
R2051:St8sia2 UTSW 7 73943202 missense possibly damaging 0.91
R4106:St8sia2 UTSW 7 73960761 missense probably damaging 1.00
R4989:St8sia2 UTSW 7 73966961 missense possibly damaging 0.75
R5859:St8sia2 UTSW 7 73966906 missense probably damaging 1.00
R6029:St8sia2 UTSW 7 73960710 missense possibly damaging 0.96
R6260:St8sia2 UTSW 7 73976693 missense possibly damaging 0.56
R6416:St8sia2 UTSW 7 73971921 missense probably damaging 1.00
R7371:St8sia2 UTSW 7 73966927 missense probably damaging 0.99
R7424:St8sia2 UTSW 7 73960902 missense possibly damaging 0.66
R7763:St8sia2 UTSW 7 73943321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCACTTAGTGCCACAAC -3'
(R):5'- TCTGGGTTGCAGCATCTTTAC -3'

Sequencing Primer
(F):5'- ACAACCCTTGCTGCTGGTG -3'
(R):5'- CTAGCAGCATGGAGACTT -3'
Posted On2016-10-24