Incidental Mutation 'R5541:Smg1'
ID435964
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene NameSMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Synonyms2610207I05Rik, 5430435M13Rik, C130002K18Rik
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118131308-118243670 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to A at 118157163 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
Predicted Effect unknown
Transcript: ENSMUST00000032891
AA Change: M2324L
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: M2324L

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083940
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208025
Meta Mutation Damage Score 0.1574 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 118198271 utr 3 prime probably benign
IGL00481:Smg1 APN 7 118210794 missense possibly damaging 0.67
IGL00503:Smg1 APN 7 118185483 utr 3 prime probably benign
IGL00927:Smg1 APN 7 118140632 missense probably damaging 1.00
IGL01333:Smg1 APN 7 118163378 splice site probably benign
IGL01344:Smg1 APN 7 118190836 utr 3 prime probably benign
IGL01397:Smg1 APN 7 118163221 utr 3 prime probably benign
IGL01403:Smg1 APN 7 118158132 utr 3 prime probably benign
IGL01573:Smg1 APN 7 118167962 utr 3 prime probably benign
IGL01872:Smg1 APN 7 118148944 utr 3 prime probably benign
IGL02010:Smg1 APN 7 118186146 utr 3 prime probably benign
IGL02158:Smg1 APN 7 118212946 missense possibly damaging 0.77
IGL02268:Smg1 APN 7 118182541 missense probably benign 0.19
IGL02314:Smg1 APN 7 118154709 utr 3 prime probably benign
IGL02552:Smg1 APN 7 118195894 utr 3 prime probably benign
IGL02577:Smg1 APN 7 118203122 missense probably damaging 0.99
IGL02859:Smg1 APN 7 118148933 utr 3 prime probably benign
IGL02890:Smg1 APN 7 118185501 utr 3 prime probably benign
IGL02892:Smg1 APN 7 118167955 utr 3 prime probably benign
IGL03119:Smg1 APN 7 118195113 utr 3 prime probably benign
IGL03123:Smg1 APN 7 118157181 utr 3 prime probably benign
IGL03128:Smg1 APN 7 118203059 missense probably benign 0.03
IGL03184:Smg1 APN 7 118180380 missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 118185541 missense unknown
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0010:Smg1 UTSW 7 118171859 utr 3 prime probably benign
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0025:Smg1 UTSW 7 118212443 missense possibly damaging 0.92
R0098:Smg1 UTSW 7 118145467 missense probably benign 0.02
R0139:Smg1 UTSW 7 118152675 critical splice donor site probably null
R0371:Smg1 UTSW 7 118168300 utr 3 prime probably benign
R0415:Smg1 UTSW 7 118182468 missense probably benign 0.34
R0416:Smg1 UTSW 7 118184461 splice site probably benign
R0423:Smg1 UTSW 7 118176880 missense possibly damaging 0.53
R0600:Smg1 UTSW 7 118160383 utr 3 prime probably benign
R0626:Smg1 UTSW 7 118182383 missense possibly damaging 0.82
R0627:Smg1 UTSW 7 118167861 utr 3 prime probably benign
R0727:Smg1 UTSW 7 118166422 utr 3 prime probably benign
R0729:Smg1 UTSW 7 118146289 utr 3 prime probably benign
R0841:Smg1 UTSW 7 118143301 missense possibly damaging 0.96
R1114:Smg1 UTSW 7 118159790 utr 3 prime probably benign
R1256:Smg1 UTSW 7 118203087 missense probably damaging 1.00
R1298:Smg1 UTSW 7 118168211 utr 3 prime probably benign
R1370:Smg1 UTSW 7 118159752 utr 3 prime probably benign
R1591:Smg1 UTSW 7 118156919 utr 3 prime probably benign
R1736:Smg1 UTSW 7 118165967 splice site probably null
R1755:Smg1 UTSW 7 118203064 nonsense probably null
R1765:Smg1 UTSW 7 118139715 missense probably benign 0.03
R1789:Smg1 UTSW 7 118145798 missense possibly damaging 0.73
R1845:Smg1 UTSW 7 118154622 utr 3 prime probably benign
R1908:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1909:Smg1 UTSW 7 118154199 utr 3 prime probably benign
R1942:Smg1 UTSW 7 118158103 utr 3 prime probably benign
R2064:Smg1 UTSW 7 118156867 utr 3 prime probably benign
R2072:Smg1 UTSW 7 118163166 utr 3 prime probably benign
R2154:Smg1 UTSW 7 118158076 utr 3 prime probably benign
R2895:Smg1 UTSW 7 118189143 utr 3 prime probably benign
R2915:Smg1 UTSW 7 118210879 splice site probably benign
R3416:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3417:Smg1 UTSW 7 118148853 utr 3 prime probably benign
R3873:Smg1 UTSW 7 118154662 utr 3 prime probably benign
R4082:Smg1 UTSW 7 118160246 utr 3 prime probably benign
R4230:Smg1 UTSW 7 118148733 critical splice donor site probably null
R4304:Smg1 UTSW 7 118139518 missense probably benign 0.03
R4549:Smg1 UTSW 7 118159683 utr 3 prime probably benign
R4571:Smg1 UTSW 7 118139465 missense possibly damaging 0.72
R4638:Smg1 UTSW 7 118195926 utr 3 prime probably benign
R4642:Smg1 UTSW 7 118154264 utr 3 prime probably benign
R4656:Smg1 UTSW 7 118212951 missense probably benign 0.00
R4754:Smg1 UTSW 7 118156731 utr 3 prime probably benign
R4798:Smg1 UTSW 7 118180474 missense probably benign 0.32
R4906:Smg1 UTSW 7 118152408 utr 3 prime probably benign
R4978:Smg1 UTSW 7 118154247 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118158100 utr 3 prime probably benign
R4989:Smg1 UTSW 7 118208051 missense probably benign
R5026:Smg1 UTSW 7 118193545 utr 3 prime probably benign
R5124:Smg1 UTSW 7 118213012 missense probably benign 0.00
R5318:Smg1 UTSW 7 118160204 utr 3 prime probably benign
R5356:Smg1 UTSW 7 118195133 utr 3 prime probably benign
R5404:Smg1 UTSW 7 118206908 missense probably damaging 1.00
R5423:Smg1 UTSW 7 118146071 missense possibly damaging 0.70
R5441:Smg1 UTSW 7 118195081 utr 3 prime probably benign
R5490:Smg1 UTSW 7 118139436 missense possibly damaging 0.86
R5564:Smg1 UTSW 7 118189819 utr 3 prime probably benign
R5580:Smg1 UTSW 7 118148902 utr 3 prime probably benign
R5600:Smg1 UTSW 7 118167884 utr 3 prime probably benign
R5628:Smg1 UTSW 7 118154701 utr 3 prime probably benign
R5646:Smg1 UTSW 7 118212559 missense probably benign 0.42
R5656:Smg1 UTSW 7 118154664 utr 3 prime probably benign
R5660:Smg1 UTSW 7 118143347 missense probably benign 0.33
R5706:Smg1 UTSW 7 118145590 missense possibly damaging 0.86
R5786:Smg1 UTSW 7 118212897 missense probably benign 0.12
R5890:Smg1 UTSW 7 118190586 utr 3 prime probably benign
R5912:Smg1 UTSW 7 118154586 utr 3 prime probably benign
R5977:Smg1 UTSW 7 118141357 utr 3 prime probably benign
R5993:Smg1 UTSW 7 118140509 missense probably benign 0.33
R6161:Smg1 UTSW 7 118163330 utr 3 prime probably benign
R6187:Smg1 UTSW 7 118189163 utr 3 prime probably benign
R6264:Smg1 UTSW 7 118166087 utr 3 prime probably benign
R6331:Smg1 UTSW 7 118154277 utr 3 prime probably benign
R6561:Smg1 UTSW 7 118166077 utr 3 prime probably benign
R6571:Smg1 UTSW 7 118184514 utr 3 prime probably benign
R6736:Smg1 UTSW 7 118157166 utr 3 prime probably benign
R6752:Smg1 UTSW 7 118163316 utr 3 prime probably benign
R6777:Smg1 UTSW 7 118189117 utr 3 prime probably benign
R6788:Smg1 UTSW 7 118184571 utr 3 prime probably benign
R6883:Smg1 UTSW 7 118168180 utr 3 prime probably benign
R6991:Smg1 UTSW 7 118167868 utr 3 prime probably benign
R7056:Smg1 UTSW 7 118146400 splice site probably benign
R7058:Smg1 UTSW 7 118198279 utr 3 prime probably benign
R7100:Smg1 UTSW 7 118184520 missense unknown
R7133:Smg1 UTSW 7 118152908 missense unknown
R7221:Smg1 UTSW 7 118182797 missense possibly damaging 0.86
R7229:Smg1 UTSW 7 118176955 missense probably benign 0.03
R7293:Smg1 UTSW 7 118166099 missense unknown
R7361:Smg1 UTSW 7 118184977 missense unknown
R7438:Smg1 UTSW 7 118195893 missense unknown
Z1088:Smg1 UTSW 7 118154635 utr 3 prime probably benign
Z1088:Smg1 UTSW 7 118168661 nonsense probably null
Z1088:Smg1 UTSW 7 118178399 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CACTTTCTCGGGAACTCTAAGG -3'
(R):5'- ATGTGCAGCAGTCTTAAGGAG -3'

Sequencing Primer
(F):5'- CGGGAACTCTAAGGCTTTTACC -3'
(R):5'- CAGTCTTAAGGAGTGCTTTGTG -3'
Posted On2016-10-24