Incidental Mutation 'R5541:Taf1d'
ID435968
Institutional Source Beutler Lab
Gene Symbol Taf1d
Ensembl Gene ENSMUSG00000031939
Gene NameTATA-box binding protein associated factor, RNA polymerase I, D
SynonymsTAF(I)41, TAFI41, 4930553M18Rik, Josd3
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15306214-15316991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15308850 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 132 (F132I)
Ref Sequence ENSEMBL: ENSMUSP00000149377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034415] [ENSMUST00000164079] [ENSMUST00000178977] [ENSMUST00000180339] [ENSMUST00000213763] [ENSMUST00000214054] [ENSMUST00000215124] [ENSMUST00000216109] [ENSMUST00000216825] [ENSMUST00000216955]
Predicted Effect probably damaging
Transcript: ENSMUST00000034415
AA Change: F132I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000034415
Gene: ENSMUSG00000031939
AA Change: F132I

DomainStartEndE-ValueType
Pfam:TAF1D 27 243 4.3e-104 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083348
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104426
Predicted Effect probably damaging
Transcript: ENSMUST00000164079
AA Change: F132I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129141
Gene: ENSMUSG00000031939
AA Change: F132I

DomainStartEndE-ValueType
Pfam:TAF1D 27 243 5.4e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178977
SMART Domains Protein: ENSMUSP00000136335
Gene: ENSMUSG00000031938

DomainStartEndE-ValueType
DUF1907 19 303 3.83e-200 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000180339
SMART Domains Protein: ENSMUSP00000136717
Gene: ENSMUSG00000031938

DomainStartEndE-ValueType
DUF1907 19 303 3.83e-200 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213317
Predicted Effect probably damaging
Transcript: ENSMUST00000213763
AA Change: F132I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213923
Predicted Effect probably damaging
Transcript: ENSMUST00000214054
AA Change: F132I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214221
Predicted Effect probably benign
Transcript: ENSMUST00000214316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214899
Predicted Effect possibly damaging
Transcript: ENSMUST00000215124
AA Change: F132I

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215741
Predicted Effect probably benign
Transcript: ENSMUST00000215749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216073
Predicted Effect probably benign
Transcript: ENSMUST00000216109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216768
Predicted Effect probably damaging
Transcript: ENSMUST00000216825
AA Change: F132I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000216955
Meta Mutation Damage Score 0.4407 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TAF1D is a member of the SL1 complex, which includes TBP (MIM 600075) and TAF1A (MIM 604903), TAF1B (MIM 604904), and TAF1C (MIM 604905), and plays a role in RNA polymerase I transcription (Wang et al., 2004 [PubMed 15520167]; Gorski et al., 2007 [PubMed 17318177]).[supplied by OMIM, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Taf1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Taf1d APN 9 15311603 missense probably damaging 0.99
IGL01861:Taf1d APN 9 15308739 unclassified probably null
IGL02448:Taf1d APN 9 15310394 nonsense probably null
IGL03106:Taf1d APN 9 15309941 missense possibly damaging 0.83
R0026:Taf1d UTSW 9 15308648 missense probably damaging 1.00
R0026:Taf1d UTSW 9 15308648 missense probably damaging 1.00
R0079:Taf1d UTSW 9 15309944 missense probably benign 0.08
R4298:Taf1d UTSW 9 15308643 missense probably damaging 1.00
R4379:Taf1d UTSW 9 15311981 intron probably benign
R4381:Taf1d UTSW 9 15311981 intron probably benign
R4927:Taf1d UTSW 9 15309954 missense probably damaging 0.99
R6072:Taf1d UTSW 9 15311560 missense probably benign 0.00
R6736:Taf1d UTSW 9 15307823 critical splice donor site probably null
R7527:Taf1d UTSW 9 15308837 missense possibly damaging 0.94
X0057:Taf1d UTSW 9 15308520 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCTTCTATAGAACCAAGGCCTC -3'
(R):5'- TGGAGCACTTTATATGGATGTCAC -3'

Sequencing Primer
(F):5'- AGGCCTCTGACTTTAAAGGC -3'
(R):5'- CAATCTTACCTAATGTATTCACCT -3'
Posted On2016-10-24