Incidental Mutation 'R5541:Dnah9'
ID435979
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Namedynein, axonemal, heavy chain 9
SynonymsD11Ertd686e, Dnahc9
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location65831282-66168551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66145336 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 416 (Y416C)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665] [ENSMUST00000108691]
Predicted Effect probably damaging
Transcript: ENSMUST00000080665
AA Change: Y416C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: Y416C

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108691
AA Change: Y218C

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104331
Gene: ENSMUSG00000056752
AA Change: Y218C

DomainStartEndE-ValueType
Pfam:DHC_N1 10 457 2.3e-141 PFAM
Meta Mutation Damage Score 0.2561 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65841238 splice site probably benign
IGL00805:Dnah9 APN 11 65881695 missense probably benign 0.00
IGL00826:Dnah9 APN 11 65989942 missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65849980 missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 66072056 missense probably damaging 1.00
IGL01353:Dnah9 APN 11 66080571 missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66155459 missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65955717 missense probably benign 0.14
IGL01537:Dnah9 APN 11 65947680 missense probably benign
IGL01565:Dnah9 APN 11 66033829 missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66118830 missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65831615 nonsense probably null
IGL01625:Dnah9 APN 11 66044645 missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66118829 missense probably damaging 1.00
IGL01819:Dnah9 APN 11 66108126 missense probably benign 0.33
IGL01896:Dnah9 APN 11 66130666 missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 66075034 splice site probably benign
IGL01923:Dnah9 APN 11 66125235 splice site probably benign
IGL02059:Dnah9 APN 11 66072958 missense probably damaging 1.00
IGL02068:Dnah9 APN 11 66061045 missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66117492 missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65927700 missense probably damaging 1.00
IGL02264:Dnah9 APN 11 66080488 splice site probably benign
IGL02325:Dnah9 APN 11 65834217 missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66125153 missense probably benign
IGL02440:Dnah9 APN 11 65955246 missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65947618 nonsense probably null
IGL02496:Dnah9 APN 11 66029363 missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65927601 missense probably benign 0.02
IGL02718:Dnah9 APN 11 65886640 missense probably damaging 0.99
IGL02832:Dnah9 APN 11 66040346 missense probably damaging 1.00
IGL02851:Dnah9 APN 11 66037744 splice site probably benign
IGL02859:Dnah9 APN 11 65881619 splice site probably benign
IGL02864:Dnah9 APN 11 66061003 missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66118967 missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65855272 missense probably damaging 0.98
IGL02987:Dnah9 APN 11 65841273 missense probably benign 0.23
IGL03160:Dnah9 APN 11 66108054 missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65981241 missense probably benign 0.13
IGL03180:Dnah9 APN 11 65886639 missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65947542 missense probably damaging 1.00
anarchy UTSW 11 65955248 missense probably damaging 0.99
sacco UTSW 11 66168079 missense possibly damaging 0.82
vanzetti UTSW 11 65855372 nonsense probably null
IGL02837:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 66005013 missense probably benign 0.44
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0070:Dnah9 UTSW 11 66160040 missense probably benign 0.10
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0180:Dnah9 UTSW 11 66147290 missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65895905 missense probably benign 0.30
R0230:Dnah9 UTSW 11 65855315 missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65911852 missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65911789 critical splice donor site probably null
R0288:Dnah9 UTSW 11 66025134 critical splice donor site probably null
R0309:Dnah9 UTSW 11 66026972 splice site probably benign
R0356:Dnah9 UTSW 11 66130562 critical splice donor site probably null
R0403:Dnah9 UTSW 11 66084789 missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 66108135 missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65918713 splice site probably benign
R0496:Dnah9 UTSW 11 66075135 missense probably null 1.00
R0557:Dnah9 UTSW 11 66084666 missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65990489 missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66118877 missense probably benign 0.02
R0599:Dnah9 UTSW 11 65965689 missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65841333 missense probably damaging 1.00
R0666:Dnah9 UTSW 11 66085458 missense probably benign 0.01
R0715:Dnah9 UTSW 11 66081248 splice site probably benign
R0726:Dnah9 UTSW 11 65965681 missense probably damaging 1.00
R0737:Dnah9 UTSW 11 66107898 missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66155530 missense probably benign 0.30
R0792:Dnah9 UTSW 11 65896001 missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 66005176 missense probably benign 0.00
R0973:Dnah9 UTSW 11 66005837 unclassified probably null
R0974:Dnah9 UTSW 11 66005837 unclassified probably null
R1055:Dnah9 UTSW 11 66160011 missense probably damaging 1.00
R1081:Dnah9 UTSW 11 66084877 missense probably damaging 0.99
R1184:Dnah9 UTSW 11 66084612 critical splice donor site probably null
R1225:Dnah9 UTSW 11 65871060 missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65927588 missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65955747 missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65874132 missense probably benign 0.22
R1447:Dnah9 UTSW 11 66108482 missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65927786 missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1486:Dnah9 UTSW 11 65834272 missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65881761 missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66112330 missense probably benign
R1617:Dnah9 UTSW 11 65895921 missense probably damaging 1.00
R1623:Dnah9 UTSW 11 66037637 missense probably damaging 1.00
R1626:Dnah9 UTSW 11 66085267 missense probably benign 0.05
R1671:Dnah9 UTSW 11 65927963 missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65954824 nonsense probably null
R1701:Dnah9 UTSW 11 65911924 missense probably damaging 1.00
R1702:Dnah9 UTSW 11 66085195 missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65915154 missense probably benign 0.11
R1718:Dnah9 UTSW 11 66168079 missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65981222 missense probably benign 0.31
R1784:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66119594 critical splice donor site probably null
R1801:Dnah9 UTSW 11 65955297 missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65850061 missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66118841 missense probably benign 0.10
R1840:Dnah9 UTSW 11 65834198 nonsense probably null
R1847:Dnah9 UTSW 11 65834386 missense probably damaging 1.00
R1872:Dnah9 UTSW 11 66037490 missense probably benign 0.16
R1929:Dnah9 UTSW 11 65976398 missense probably benign 0.05
R1969:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R1971:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65955338 missense probably benign 0.11
R2049:Dnah9 UTSW 11 66044683 missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66145435 missense probably benign 0.31
R2104:Dnah9 UTSW 11 66061124 missense probably damaging 1.00
R2109:Dnah9 UTSW 11 66037585 missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66117483 missense probably damaging 1.00
R2172:Dnah9 UTSW 11 66072779 missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65859499 missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2272:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2396:Dnah9 UTSW 11 66085158 missense probably benign 0.01
R2398:Dnah9 UTSW 11 65915203 missense probably damaging 1.00
R2418:Dnah9 UTSW 11 66095415 nonsense probably null
R2419:Dnah9 UTSW 11 66095415 nonsense probably null
R2510:Dnah9 UTSW 11 66005169 missense probably damaging 1.00
R2680:Dnah9 UTSW 11 66033925 missense probably benign 0.00
R2875:Dnah9 UTSW 11 66168461 missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66117588 missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3237:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3433:Dnah9 UTSW 11 66075112 missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66156908 nonsense probably null
R3820:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3821:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3822:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3861:Dnah9 UTSW 11 66052994 splice site probably benign
R3918:Dnah9 UTSW 11 65870974 missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65834464 missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66133635 missense probably benign 0.03
R4072:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4076:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4097:Dnah9 UTSW 11 65990459 missense probably damaging 1.00
R4409:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65981214 missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66118749 missense probably benign 0.00
R4434:Dnah9 UTSW 11 66108075 missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65881641 missense probably benign 0.07
R4452:Dnah9 UTSW 11 66027082 missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66147389 missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4590:Dnah9 UTSW 11 66040392 missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66168152 missense probably benign
R4655:Dnah9 UTSW 11 65955732 missense probably benign 0.00
R4667:Dnah9 UTSW 11 66155531 missense probably benign
R4718:Dnah9 UTSW 11 66085473 missense probably benign
R4720:Dnah9 UTSW 11 66076358 missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65927726 missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65874124 nonsense probably null
R4963:Dnah9 UTSW 11 66084611 splice site probably null
R5074:Dnah9 UTSW 11 65850040 missense probably damaging 1.00
R5230:Dnah9 UTSW 11 66084666 missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66112333 missense probably benign 0.34
R5364:Dnah9 UTSW 11 65881696 missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 66029354 missense probably damaging 1.00
R5386:Dnah9 UTSW 11 66029356 missense probably damaging 1.00
R5389:Dnah9 UTSW 11 66095314 nonsense probably null
R5560:Dnah9 UTSW 11 65881740 missense probably benign 0.00
R5576:Dnah9 UTSW 11 65834096 splice site probably null
R5648:Dnah9 UTSW 11 65927755 missense probably benign 0.00
R5653:Dnah9 UTSW 11 65849980 missense probably damaging 0.99
R5713:Dnah9 UTSW 11 66025223 missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65955239 missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66126601 missense probably benign 0.01
R5831:Dnah9 UTSW 11 66108121 missense probably benign 0.00
R5847:Dnah9 UTSW 11 66095240 frame shift probably null
R5870:Dnah9 UTSW 11 66085210 missense probably benign 0.01
R5902:Dnah9 UTSW 11 66025187 missense probably benign 0.08
R5918:Dnah9 UTSW 11 65834199 missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65834481 missense probably damaging 1.00
R6065:Dnah9 UTSW 11 65855338 missense probably benign 0.05
R6065:Dnah9 UTSW 11 66145397 missense possibly damaging 0.65
R6086:Dnah9 UTSW 11 65989915 missense probably damaging 0.99
R6086:Dnah9 UTSW 11 66085174 missense probably benign
R6102:Dnah9 UTSW 11 65990516 missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66147399 missense probably benign
R6154:Dnah9 UTSW 11 65855338 missense probably benign 0.00
R6262:Dnah9 UTSW 11 65881805 splice site probably null
R6265:Dnah9 UTSW 11 66168094 missense probably benign 0.04
R6290:Dnah9 UTSW 11 65841375 missense probably damaging 1.00
R6345:Dnah9 UTSW 11 66037693 missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65955248 missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66168281 missense probably benign 0.37
R6582:Dnah9 UTSW 11 66061097 missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65955366 missense probably damaging 1.00
R6800:Dnah9 UTSW 11 66072739 critical splice donor site probably null
R6812:Dnah9 UTSW 11 65981329 missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66117626 missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 66085149 missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 66076341 missense probably damaging 1.00
R6977:Dnah9 UTSW 11 66107909 missense probably benign 0.37
R7021:Dnah9 UTSW 11 65981231 missense probably benign
R7161:Dnah9 UTSW 11 65855372 nonsense probably null
R7175:Dnah9 UTSW 11 66133637 missense probably benign 0.03
R7199:Dnah9 UTSW 11 66118944 missense probably benign 0.04
R7231:Dnah9 UTSW 11 65965647 missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65990476 missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65989851 missense probably benign 0.00
R7350:Dnah9 UTSW 11 66080578 missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66117407 critical splice donor site probably null
R7427:Dnah9 UTSW 11 65955219 missense probably benign
R7477:Dnah9 UTSW 11 65992731 missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65841414 missense probably benign 0.01
R7521:Dnah9 UTSW 11 65989837 missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66125215 missense probably benign 0.43
R7659:Dnah9 UTSW 11 65989780 missense probably damaging 0.99
R7707:Dnah9 UTSW 11 66118958 missense probably damaging 1.00
V3553:Dnah9 UTSW 11 65970076 missense probably damaging 1.00
X0027:Dnah9 UTSW 11 66085479 missense probably benign 0.07
X0028:Dnah9 UTSW 11 65990452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTCAGTCAACCATGGGTGAC -3'
(R):5'- GCAGCTGCCATTATACTTGTAGATAC -3'

Sequencing Primer
(F):5'- TCTCTGTAACTGTGAGCCAAGAC -3'
(R):5'- GATACTAATTTATTTACCTCCCAGGC -3'
Posted On2016-10-24