Incidental Mutation 'R5541:March10'
ID435980
Institutional Source Beutler Lab
Gene Symbol March10
Ensembl Gene ENSMUSG00000078627
Gene Namemembrane-associated ring finger (C3HC4) 10
Synonyms4933417C16Rik, OTTMUSG00000002847, Rnf190
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105360798-105456735 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 105390131 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 443 (D443N)
Ref Sequence ENSEMBL: ENSMUSP00000121919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049995] [ENSMUST00000138977]
Predicted Effect probably damaging
Transcript: ENSMUST00000049995
AA Change: D443N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000063198
Gene: ENSMUSG00000078627
AA Change: D443N

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138977
AA Change: D443N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121919
Gene: ENSMUSG00000078627
AA Change: D443N

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
low complexity region 56 71 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
RINGv 638 695 7.45e-22 SMART
low complexity region 728 737 N/A INTRINSIC
low complexity region 767 781 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153672
Meta Mutation Damage Score 0.5176 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH10 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments (Morokuma et al., 2007 [PubMed 17604280]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in March10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:March10 APN 11 105402188 missense possibly damaging 0.82
IGL01461:March10 APN 11 105389605 missense probably damaging 1.00
IGL01473:March10 APN 11 105389605 missense probably damaging 1.00
Forward UTSW 11 105382237 missense probably damaging 1.00
PIT4142001:March10 UTSW 11 105390520 missense probably benign 0.17
R0195:March10 UTSW 11 105385525 missense probably damaging 1.00
R0520:March10 UTSW 11 105389882 missense probably benign
R0628:March10 UTSW 11 105390160 missense probably benign 0.00
R1087:March10 UTSW 11 105390662 missense probably damaging 1.00
R1440:March10 UTSW 11 105390583 missense probably damaging 1.00
R1802:March10 UTSW 11 105389915 missense probably benign 0.00
R1855:March10 UTSW 11 105390392 missense probably benign
R1860:March10 UTSW 11 105397078 missense probably damaging 0.99
R2504:March10 UTSW 11 105385572 missense probably damaging 1.00
R3788:March10 UTSW 11 105397079 missense probably damaging 1.00
R4629:March10 UTSW 11 105389838 missense probably benign 0.28
R4755:March10 UTSW 11 105364476 intron probably benign
R4776:March10 UTSW 11 105390037 missense probably benign 0.42
R5067:March10 UTSW 11 105390107 missense possibly damaging 0.51
R5192:March10 UTSW 11 105371926 missense possibly damaging 0.68
R5436:March10 UTSW 11 105402165 missense possibly damaging 0.92
R5888:March10 UTSW 11 105402146 missense possibly damaging 0.92
R5908:March10 UTSW 11 105390239 missense probably benign 0.00
R5914:March10 UTSW 11 105385482 missense probably damaging 1.00
R6038:March10 UTSW 11 105402051 missense probably damaging 0.96
R6178:March10 UTSW 11 105389614 missense probably damaging 1.00
R6300:March10 UTSW 11 105382237 missense probably damaging 1.00
R6612:March10 UTSW 11 105397078 missense probably damaging 0.99
R6894:March10 UTSW 11 105396961 missense possibly damaging 0.94
R6921:March10 UTSW 11 105389777 missense probably benign 0.00
R7134:March10 UTSW 11 105408676 missense probably benign
R7199:March10 UTSW 11 105390706 missense probably damaging 0.99
R7546:March10 UTSW 11 105390080 missense not run
R7792:March10 UTSW 11 105390228 missense probably benign
Z1088:March10 UTSW 11 105390359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCGGCGTACATTAAAC -3'
(R):5'- GCTCCAAGATACCAGGTTACCC -3'

Sequencing Primer
(F):5'- GCCGGCGTACATTAAACCTTAGG -3'
(R):5'- ATACCAGGTTACCCAGTGAGTTG -3'
Posted On2016-10-24