Mutagenetix > Incidental Mutations

Incidental Mutation 'R5541:Wapl'

435987

Institutional Source

Beutler Lab

Gene Symbol

Wapl

Ensembl Gene

ENSMUSG00000041408

Gene Name

WAPL cohesin release factor

Synonyms

A530089A20Rik, Wapal

MMRRC Submission

043099-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5541 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

34673928-34747983 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 34730662 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130547 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000090027] [ENSMUST00000169910]

Predicted Effect

probably null
Transcript: ENSMUST00000048263

SMART Domains

Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	645	1009	6.5e-153	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000090027

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000090027

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111895

Predicted Effect

probably null
Transcript: ENSMUST00000151285

SMART Domains

Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
Pfam:WAPL	1	281	1.1e-78	PFAM
coiled coil region	329	351	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000151285

SMART Domains

Protein: ENSMUSP00000117282
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
Pfam:WAPL	1	281	1.1e-78	PFAM
coiled coil region	329	351	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000169910

SMART Domains

Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	647	1008	3.5e-120	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Meta Mutation Damage Score

0.9595

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.2%

Validation Efficiency

100% (63/63)

MGI Phenotype

FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009B22Rik	T	C	11: 51,685,969	H34R	probably benign	Het
1700113H08Rik	A	G	10: 87,225,946	K86R	probably benign	Het
Abca13	T	C	11: 9,291,545	V1136A	probably benign	Het
Als2cr12	A	G	1: 58,658,429	M384T	probably benign	Het
Arfgap2	G	A	2: 91,275,769	R530H	probably benign	Het
Arhgap30	T	C	1: 171,404,139		probably null	Het
Asb7	T	C	7: 66,679,269	R8G	probably benign	Het
Bod1l	T	C	5: 41,791,933	N2949D	probably benign	Het
Ccdc86	T	C	19: 10,948,554	E227G	probably damaging	Het
Cercam	A	G	2: 29,875,629	D261G	probably benign	Het
Chd9	A	T	8: 91,051,504	E2714D	probably benign	Het
Dcp1a	T	A	14: 30,502,839	S126R	probably damaging	Het
Defa17	T	A	8: 21,656,549	C64S	probably damaging	Het
Depdc5	A	T	5: 32,864,629		probably benign	Het
Dhx29	A	G	13: 112,940,374	N259S	possibly damaging	Het
Dnah6	A	T	6: 73,192,988	L323Q	possibly damaging	Het
Dnah9	T	C	11: 66,145,336	Y416C	probably damaging	Het
Faap100	T	A	11: 120,377,632	E105V	possibly damaging	Het
Fbxw15	T	G	9: 109,565,430	I106L	probably benign	Het
Gm10610	A	G	7: 83,549,406		noncoding transcript	Het
Gpr22	A	G	12: 31,709,349	F258S	probably damaging	Het
Grip1	A	T	10: 120,072,718	I618F	probably damaging	Het
H2afy2	T	C	10: 61,747,717	I215V	probably benign	Het
Hspg2	C	T	4: 137,520,551	T1233I	probably damaging	Het
Hspg2	C	A	4: 137,542,825	Q2365K	probably benign	Het
Intu	A	G	3: 40,692,587		probably null	Het
Kdm1b	T	C	13: 47,079,196	M714T	probably damaging	Het
Kif21a	A	G	15: 90,968,113	M924T	probably damaging	Het
Klb	A	T	5: 65,379,234	M636L	probably benign	Het
Klrb1a	G	A	6: 128,609,736	H219Y	probably benign	Het
March10	C	T	11: 105,390,131	D443N	probably damaging	Het
Nos1	A	G	5: 117,905,394	E578G	probably damaging	Het
Olfr1502	T	C	19: 13,861,964	I57T	probably benign	Het
Olfr887	T	C	9: 38,085,123	C96R	probably damaging	Het
Pard3b	A	G	1: 61,639,343	Y34C	probably damaging	Het
Pcdh17	T	A	14: 84,447,416	V441E	probably damaging	Het
Pde6g	A	T	11: 120,448,172	I64N	probably damaging	Het
Pdia4	C	T	6: 47,796,637	V593M	probably damaging	Het
Pnn	T	G	12: 59,071,930	V433G	possibly damaging	Het
Rbak	G	A	5: 143,173,990	S436F	probably damaging	Het
Rpl11	A	G	4: 136,052,732		probably benign	Het
Ryr1	G	T	7: 29,086,185	Q1701K	probably damaging	Het
Scn1a	T	A	2: 66,324,633	T661S	probably benign	Het
Smg1	T	A	7: 118,157,163		probably benign	Het
St8sia2	T	C	7: 73,966,900	D109G	probably benign	Het
Stk-ps1	T	A	17: 36,398,213		noncoding transcript	Het
Stxbp3-ps	C	T	19: 9,557,970		noncoding transcript	Het
Taf1d	T	A	9: 15,308,850	F132I	probably damaging	Het
Tfap2b	A	G	1: 19,214,026	S35G	possibly damaging	Het
Tnk2	C	T	16: 32,669,523	T198I	probably benign	Het
Ube2q2	T	A	9: 55,191,879	V168E	possibly damaging	Het
Ucma	A	G	2: 4,981,330	R105G	probably benign	Het
Vmn2r97	C	T	17: 18,928,355	Q171*	probably null	Het
Zfand4	T	A	6: 116,314,295	C397S	possibly damaging	Het
Zfhx3	A	G	8: 108,948,951	N2211S	probably damaging	Het
Zfp143	G	T	7: 110,070,480	G39C	probably benign	Het
Zfp568	T	A	7: 30,022,876	D414E	possibly damaging	Het
Zfp574	C	T	7: 25,081,950	A799V	probably damaging	Het

Other mutations in Wapl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Wapl	APN	14	34692636	missense	probably benign	0.00
IGL00539:Wapl	APN	14	34695008	missense	probably damaging	1.00
IGL00846:Wapl	APN	14	34692744	splice site	probably benign
IGL01070:Wapl	APN	14	34745622	unclassified	probably benign
IGL01516:Wapl	APN	14	34692081	missense	probably damaging	1.00
IGL02021:Wapl	APN	14	34722336	missense	probably benign
IGL02209:Wapl	APN	14	34677261	missense	possibly damaging	0.46
IGL02309:Wapl	APN	14	34744863	missense	probably damaging	0.98
IGL02471:Wapl	APN	14	34691920	missense	possibly damaging	0.68
IGL02965:Wapl	APN	14	34739224	intron	probably benign
IGL03076:Wapl	APN	14	34692089	missense	probably benign	0.26
IGL03197:Wapl	APN	14	34745631	missense	possibly damaging	0.77
Mcclintock	UTSW	14	34730662	critical splice donor site	probably null
R0045:Wapl	UTSW	14	34733794	missense	probably benign	0.18
R0278:Wapl	UTSW	14	34692612	missense	possibly damaging	0.68
R0335:Wapl	UTSW	14	34692324	missense	probably damaging	0.99
R1018:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R1295:Wapl	UTSW	14	34724769	missense	probably damaging	1.00
R1553:Wapl	UTSW	14	34729190	missense	probably damaging	1.00
R1868:Wapl	UTSW	14	34692458	missense	probably benign	0.00
R1909:Wapl	UTSW	14	34691912	missense	probably damaging	1.00
R2698:Wapl	UTSW	14	34691777	missense	probably benign
R2990:Wapl	UTSW	14	34736708	missense	probably damaging	0.98
R3121:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3122:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3147:Wapl	UTSW	14	34725149	missense	probably damaging	1.00
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3733:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3878:Wapl	UTSW	14	34692147	missense	probably damaging	1.00
R4034:Wapl	UTSW	14	34737914	missense	possibly damaging	0.92
R4934:Wapl	UTSW	14	34692095	missense	probably benign	0.11
R5079:Wapl	UTSW	14	34724757	missense	probably damaging	1.00
R5104:Wapl	UTSW	14	34692059	nonsense	probably null
R5113:Wapl	UTSW	14	34724754	missense	probably damaging	1.00
R5121:Wapl	UTSW	14	34677162	missense	probably benign	0.01
R5222:Wapl	UTSW	14	34736685	nonsense	probably null
R5299:Wapl	UTSW	14	34733808	critical splice donor site	probably null
R5387:Wapl	UTSW	14	34677295	missense	probably benign	0.00
R5618:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R5802:Wapl	UTSW	14	34692320	missense	probably damaging	1.00
R6029:Wapl	UTSW	14	34739247	missense	possibly damaging	0.94
R6292:Wapl	UTSW	14	34729195	missense	probably damaging	1.00
R6482:Wapl	UTSW	14	34692692	missense	probably benign	0.01
R6487:Wapl	UTSW	14	34692292	missense	probably damaging	1.00
R6925:Wapl	UTSW	14	34677363	missense	probably benign	0.31
R6937:Wapl	UTSW	14	34722354	missense	probably benign	0.01
R7080:Wapl	UTSW	14	34692356	missense	probably benign	0.03
R7203:Wapl	UTSW	14	34736691	missense	probably benign
R7944:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7945:Wapl	UTSW	14	34677148	missense	probably benign	0.00
R7969:Wapl	UTSW	14	34730647	missense	probably damaging	1.00
R8038:Wapl	UTSW	14	34691682	missense	probably benign
R8053:Wapl	UTSW	14	34692321	missense	probably damaging	1.00
Z1177:Wapl	UTSW	14	34745690	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- GCGGATCTCTGAGTTTGAGGTAA -3'
(R):5'- TCACAGTGTCTCCAATTTTGTGC -3'

Sequencing Primer
(F):5'- TAAGCCTGGTCTACAGAGTG -3'
(R):5'- TTCTCTTCTATGTAGCCCTG -3'

Posted On

2016-10-24