Incidental Mutation 'R5541:Ccdc86'
ID435994
Institutional Source Beutler Lab
Gene Symbol Ccdc86
Ensembl Gene ENSMUSG00000024732
Gene Namecoiled-coil domain containing 86
Synonyms4933411H20Rik, 6720480F16Rik, D19Ertd678e, cyclon
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10941481-10949266 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10948554 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 227 (E227G)
Ref Sequence ENSEMBL: ENSMUSP00000025639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025639]
Predicted Effect probably damaging
Transcript: ENSMUST00000025639
AA Change: E227G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025639
Gene: ENSMUSG00000024732
AA Change: E227G

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 67 84 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 107 124 N/A INTRINSIC
low complexity region 127 144 N/A INTRINSIC
low complexity region 187 201 N/A INTRINSIC
coiled coil region 338 389 N/A INTRINSIC
low complexity region 392 400 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189018
Meta Mutation Damage Score 0.1186 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype PHENOTYPE: Homozygous null mice are embryonic lethal. CD4 T cells in heterozygote mice are resistant to activation induced cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr1502 T C 19: 13,861,964 I57T probably benign Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Ccdc86
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Ccdc86 APN 19 10943192 missense possibly damaging 0.61
BB006:Ccdc86 UTSW 19 10948819 missense unknown
BB016:Ccdc86 UTSW 19 10948819 missense unknown
R4453:Ccdc86 UTSW 19 10948519 missense probably damaging 1.00
R6180:Ccdc86 UTSW 19 10948581 missense possibly damaging 0.63
R6471:Ccdc86 UTSW 19 10948879 missense unknown
R7647:Ccdc86 UTSW 19 10948999 missense unknown
R7929:Ccdc86 UTSW 19 10948819 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTTCGGAATTACAGGAAGCTCC -3'
(R):5'- GGTCCCTTCAACCTCATCAAG -3'

Sequencing Primer
(F):5'- CAATTTCTTGGACGCTGGGGC -3'
(R):5'- TCATCAAGATCTGGGCCTGGAG -3'
Posted On2016-10-24