Incidental Mutation 'R5541:Olfr1502'
ID435995
Institutional Source Beutler Lab
Gene Symbol Olfr1502
Ensembl Gene ENSMUSG00000056858
Gene Nameolfactory receptor 1502
SynonymsGA_x6K02T2RE5P-4193992-4194942, MOR211-1
MMRRC Submission 043099-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5541 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13861795-13862745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13861964 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 57 (I57T)
Ref Sequence ENSEMBL: ENSMUSP00000073843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074221]
Predicted Effect probably benign
Transcript: ENSMUST00000074221
AA Change: I57T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073843
Gene: ENSMUSG00000056858
AA Change: I57T

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 7.1e-43 PFAM
Pfam:7tm_1 41 290 1.6e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.2%
Validation Efficiency 100% (63/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,969 H34R probably benign Het
1700113H08Rik A G 10: 87,225,946 K86R probably benign Het
Abca13 T C 11: 9,291,545 V1136A probably benign Het
Als2cr12 A G 1: 58,658,429 M384T probably benign Het
Arfgap2 G A 2: 91,275,769 R530H probably benign Het
Arhgap30 T C 1: 171,404,139 probably null Het
Asb7 T C 7: 66,679,269 R8G probably benign Het
Bod1l T C 5: 41,791,933 N2949D probably benign Het
Ccdc86 T C 19: 10,948,554 E227G probably damaging Het
Cercam A G 2: 29,875,629 D261G probably benign Het
Chd9 A T 8: 91,051,504 E2714D probably benign Het
Dcp1a T A 14: 30,502,839 S126R probably damaging Het
Defa17 T A 8: 21,656,549 C64S probably damaging Het
Depdc5 A T 5: 32,864,629 probably benign Het
Dhx29 A G 13: 112,940,374 N259S possibly damaging Het
Dnah6 A T 6: 73,192,988 L323Q possibly damaging Het
Dnah9 T C 11: 66,145,336 Y416C probably damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fbxw15 T G 9: 109,565,430 I106L probably benign Het
Gm10610 A G 7: 83,549,406 noncoding transcript Het
Gpr22 A G 12: 31,709,349 F258S probably damaging Het
Grip1 A T 10: 120,072,718 I618F probably damaging Het
H2afy2 T C 10: 61,747,717 I215V probably benign Het
Hspg2 C T 4: 137,520,551 T1233I probably damaging Het
Hspg2 C A 4: 137,542,825 Q2365K probably benign Het
Intu A G 3: 40,692,587 probably null Het
Kdm1b T C 13: 47,079,196 M714T probably damaging Het
Kif21a A G 15: 90,968,113 M924T probably damaging Het
Klb A T 5: 65,379,234 M636L probably benign Het
Klrb1a G A 6: 128,609,736 H219Y probably benign Het
March10 C T 11: 105,390,131 D443N probably damaging Het
Nos1 A G 5: 117,905,394 E578G probably damaging Het
Olfr887 T C 9: 38,085,123 C96R probably damaging Het
Pard3b A G 1: 61,639,343 Y34C probably damaging Het
Pcdh17 T A 14: 84,447,416 V441E probably damaging Het
Pde6g A T 11: 120,448,172 I64N probably damaging Het
Pdia4 C T 6: 47,796,637 V593M probably damaging Het
Pnn T G 12: 59,071,930 V433G possibly damaging Het
Rbak G A 5: 143,173,990 S436F probably damaging Het
Rpl11 A G 4: 136,052,732 probably benign Het
Ryr1 G T 7: 29,086,185 Q1701K probably damaging Het
Scn1a T A 2: 66,324,633 T661S probably benign Het
Smg1 T A 7: 118,157,163 probably benign Het
St8sia2 T C 7: 73,966,900 D109G probably benign Het
Stk-ps1 T A 17: 36,398,213 noncoding transcript Het
Stxbp3-ps C T 19: 9,557,970 noncoding transcript Het
Taf1d T A 9: 15,308,850 F132I probably damaging Het
Tfap2b A G 1: 19,214,026 S35G possibly damaging Het
Tnk2 C T 16: 32,669,523 T198I probably benign Het
Ube2q2 T A 9: 55,191,879 V168E possibly damaging Het
Ucma A G 2: 4,981,330 R105G probably benign Het
Vmn2r97 C T 17: 18,928,355 Q171* probably null Het
Wapl T C 14: 34,730,662 probably null Het
Zfand4 T A 6: 116,314,295 C397S possibly damaging Het
Zfhx3 A G 8: 108,948,951 N2211S probably damaging Het
Zfp143 G T 7: 110,070,480 G39C probably benign Het
Zfp568 T A 7: 30,022,876 D414E possibly damaging Het
Zfp574 C T 7: 25,081,950 A799V probably damaging Het
Other mutations in Olfr1502
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1502 APN 19 13861786 unclassified probably benign
IGL01061:Olfr1502 APN 19 13862705 missense possibly damaging 0.94
IGL01534:Olfr1502 APN 19 13861919 missense probably damaging 1.00
IGL02017:Olfr1502 APN 19 13862231 missense possibly damaging 0.58
IGL02039:Olfr1502 APN 19 13862719 nonsense probably null
IGL02173:Olfr1502 APN 19 13862014 missense probably benign 0.00
IGL02219:Olfr1502 APN 19 13861823 missense probably damaging 1.00
IGL02475:Olfr1502 APN 19 13862299 missense probably damaging 1.00
IGL02604:Olfr1502 APN 19 13861806 missense probably benign 0.01
R0012:Olfr1502 UTSW 19 13861823 missense probably damaging 0.98
R0594:Olfr1502 UTSW 19 13862279 missense probably benign 0.04
R2184:Olfr1502 UTSW 19 13862035 missense probably benign 0.02
R2518:Olfr1502 UTSW 19 13862309 missense probably damaging 1.00
R5587:Olfr1502 UTSW 19 13862576 missense probably damaging 1.00
R6211:Olfr1502 UTSW 19 13862574 missense probably benign 0.01
R6351:Olfr1502 UTSW 19 13861822 missense probably benign 0.04
R7575:Olfr1502 UTSW 19 13862017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCTGAAGGACAAACTCTC -3'
(R):5'- GCGATCATAGGCCATCACAGAC -3'

Sequencing Primer
(F):5'- TCTCTACATTGAATCCATGGCCAAG -3'
(R):5'- CAGCAGGAAACATTCTGTAGCTGC -3'
Posted On2016-10-24