Incidental Mutation 'R5542:Fcgbpl1'
ID 436031
Institutional Source Beutler Lab
Gene Symbol Fcgbpl1
Ensembl Gene ENSMUSG00000078776
Gene Name Fc fragment of IgG binding protein like 1
Synonyms 9530053A07Rik
MMRRC Submission 043100-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.103) question?
Stock # R5542 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 27828891-27864236 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 27854914 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1847 (I1847F)
Ref Sequence ENSEMBL: ENSMUSP00000114986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059886] [ENSMUST00000150948]
AlphaFold E9PVG8
Predicted Effect probably damaging
Transcript: ENSMUST00000059886
AA Change: I1847F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056479
Gene: ENSMUSG00000078776
AA Change: I1847F

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150948
AA Change: I1847F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114986
Gene: ENSMUSG00000078776
AA Change: I1847F

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
FOLN 27 49 1.23e-4 SMART
VWD 46 211 1.5e-40 SMART
C8 251 326 4.31e-33 SMART
Pfam:TIL 329 383 2e-13 PFAM
VWC 385 448 1.02e0 SMART
VWD 439 603 4.32e-32 SMART
C8 640 715 4.54e-9 SMART
Pfam:TIL 718 771 1.6e-12 PFAM
VWC 773 826 1.1e0 SMART
FOLN 805 827 6.87e1 SMART
VWD 825 988 7.92e-40 SMART
C8 1033 1108 5.1e-35 SMART
Pfam:TIL 1111 1164 7.6e-11 PFAM
VWC 1166 1224 1.1e-2 SMART
FOLN 1197 1219 9.55e-1 SMART
FOLN 1223 1245 5.38e1 SMART
VWD 1241 1410 9.04e-35 SMART
C8 1450 1526 9.54e-26 SMART
low complexity region 1540 1550 N/A INTRINSIC
EGF_like 1557 1580 5.34e1 SMART
VWC 1588 1681 3.21e-3 SMART
VWD 1639 1806 7.3e-30 SMART
C8 1838 1913 2.44e-32 SMART
EGF_like 1941 1964 4.46e1 SMART
VWC 1971 2062 2.85e-1 SMART
VWD 2022 2178 1.32e-27 SMART
low complexity region 2199 2212 N/A INTRINSIC
C8 2219 2294 1.43e-29 SMART
Pfam:TIL 2297 2350 1.1e-11 PFAM
FOLN 2383 2405 5.68e1 SMART
VWD 2402 2564 4.58e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 C T 3: 59,932,484 (GRCm39) T333I probably damaging Het
Acacb C T 5: 114,333,798 (GRCm39) R574C probably damaging Het
Actr10 T C 12: 71,001,430 (GRCm39) probably benign Het
Ankdd1a T A 9: 65,411,472 (GRCm39) probably null Het
Anks4b C T 7: 119,781,646 (GRCm39) Q226* probably null Het
AW146154 C A 7: 41,130,801 (GRCm39) G105V probably benign Het
Cdh4 T A 2: 179,502,019 (GRCm39) N326K probably damaging Het
Cnbd1 T C 4: 18,860,517 (GRCm39) T410A possibly damaging Het
Cndp2 A T 18: 84,690,201 (GRCm39) M247K probably damaging Het
Crx G A 7: 15,602,262 (GRCm39) R139C probably damaging Het
Ctrc A G 4: 141,571,037 (GRCm39) Y68H probably damaging Het
Ddx4 T C 13: 112,757,779 (GRCm39) D326G probably damaging Het
Edem1 C T 6: 108,831,290 (GRCm39) R584C possibly damaging Het
Emcn A G 3: 137,085,638 (GRCm39) T79A probably benign Het
Ext1 C A 15: 52,939,213 (GRCm39) W612L probably damaging Het
Fbrsl1 C T 5: 110,526,307 (GRCm39) G437R probably damaging Het
Fbxo7 A C 10: 85,869,149 (GRCm39) Q201P probably benign Het
Fbxo9 T C 9: 78,008,938 (GRCm39) M12V possibly damaging Het
Flii A G 11: 60,609,688 (GRCm39) S640P probably benign Het
Fsip2 A T 2: 82,812,207 (GRCm39) N2842I possibly damaging Het
Fst G T 13: 114,592,241 (GRCm39) Q159K probably damaging Het
Fuom A T 7: 139,680,025 (GRCm39) *109R probably null Het
Hhipl2 A G 1: 183,214,055 (GRCm39) D377G probably damaging Het
Hspa14 A G 2: 3,503,560 (GRCm39) V116A possibly damaging Het
Ighm A G 12: 113,382,601 (GRCm39) probably benign Het
Ighv1-85 T A 12: 115,963,847 (GRCm39) Y51F probably benign Het
Ighv2-3 A T 12: 113,574,833 (GRCm39) D107E probably benign Het
Ighv2-6-8 T A 12: 113,760,187 (GRCm39) M1L probably benign Het
Ipo5 T C 14: 121,163,683 (GRCm39) V247A probably benign Het
Itga9 T C 9: 118,672,729 (GRCm39) F154L possibly damaging Het
Itprid1 C A 6: 55,955,380 (GRCm39) P996Q probably damaging Het
Knl1 T A 2: 118,898,829 (GRCm39) C177S possibly damaging Het
Lrrc17 G A 5: 21,780,156 (GRCm39) G377S probably damaging Het
Marveld3 A T 8: 110,675,249 (GRCm39) I189K probably benign Het
Msantd2 G A 9: 37,428,555 (GRCm39) G185R probably damaging Het
Mtcl1 G A 17: 66,691,354 (GRCm39) probably benign Het
Muc21 T C 17: 35,933,395 (GRCm39) probably benign Het
Mycbpap A T 11: 94,398,572 (GRCm39) probably null Het
Nbeal1 A G 1: 60,316,353 (GRCm39) D1852G probably benign Het
Ndc80 A T 17: 71,807,276 (GRCm39) V560D probably benign Het
Nscme3l A T 19: 5,553,463 (GRCm39) V106D probably damaging Het
Or1e25 T A 11: 73,494,030 (GRCm39) V208E possibly damaging Het
Or2t48 A C 11: 58,420,710 (GRCm39) V34G probably benign Het
Or56a3 A T 7: 104,735,565 (GRCm39) D214V probably damaging Het
Or6a2 A T 7: 106,600,286 (GRCm39) S260R probably damaging Het
Or9i1b T C 19: 13,896,411 (GRCm39) V9A probably benign Het
Pcdhga4 A T 18: 37,819,651 (GRCm39) Y400F probably damaging Het
Pkd2 A G 5: 104,634,515 (GRCm39) silent Het
Plxna4 T A 6: 32,183,165 (GRCm39) I913F probably damaging Het
Psmc1 T C 12: 100,086,399 (GRCm39) probably null Het
Robo2 G A 16: 73,695,853 (GRCm39) T1430I probably benign Het
Safb2 G A 17: 56,882,647 (GRCm39) R329C probably damaging Het
Septin14 T C 5: 129,774,926 (GRCm39) H83R probably damaging Het
Slc16a10 A G 10: 39,952,784 (GRCm39) F237L probably benign Het
Slc37a1 A T 17: 31,559,236 (GRCm39) T439S probably damaging Het
Slc6a6 T C 6: 91,712,170 (GRCm39) F233S probably damaging Het
Smyd3 A T 1: 179,238,024 (GRCm39) D114E probably benign Het
Sned1 T C 1: 93,199,324 (GRCm39) I468T probably benign Het
Speer4a1 T A 5: 26,241,736 (GRCm39) N130I probably damaging Het
Tdrd7 T C 4: 46,029,757 (GRCm39) V1030A probably benign Het
Trip12 A T 1: 84,727,065 (GRCm39) D1135E probably damaging Het
Tsga10 T A 1: 37,800,598 (GRCm39) D542V probably damaging Het
Ubqlnl G A 7: 103,798,904 (GRCm39) Q198* probably null Het
Unc93a2 A T 17: 7,637,187 (GRCm39) C334S probably benign Het
Usp46 A T 5: 74,189,902 (GRCm39) M43K probably benign Het
Vmn1r175 A T 7: 23,508,531 (GRCm39) I32N possibly damaging Het
Vmn1r29 C T 6: 58,285,108 (GRCm39) T276I probably benign Het
Vmn1r81 A T 7: 11,994,034 (GRCm39) D191E probably damaging Het
Zbtb5 C A 4: 44,995,052 (GRCm39) V111F probably damaging Het
Zfp12 C T 5: 143,230,240 (GRCm39) P189L possibly damaging Het
Zfp729b A G 13: 67,739,140 (GRCm39) F1042L probably benign Het
Other mutations in Fcgbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Fcgbpl1 APN 7 27,863,953 (GRCm39) missense probably damaging 1.00
IGL00757:Fcgbpl1 APN 7 27,853,870 (GRCm39) missense probably damaging 1.00
IGL01015:Fcgbpl1 APN 7 27,854,743 (GRCm39) missense probably damaging 1.00
IGL01079:Fcgbpl1 APN 7 27,839,203 (GRCm39) missense probably damaging 0.99
IGL01343:Fcgbpl1 APN 7 27,850,127 (GRCm39) missense probably benign 0.19
IGL01420:Fcgbpl1 APN 7 27,839,558 (GRCm39) missense probably benign 0.28
IGL01604:Fcgbpl1 APN 7 27,854,749 (GRCm39) missense probably benign 0.11
IGL01666:Fcgbpl1 APN 7 27,852,717 (GRCm39) missense probably damaging 1.00
IGL02002:Fcgbpl1 APN 7 27,852,221 (GRCm39) missense probably damaging 1.00
IGL02036:Fcgbpl1 APN 7 27,836,950 (GRCm39) missense possibly damaging 0.82
IGL02126:Fcgbpl1 APN 7 27,839,281 (GRCm39) missense probably damaging 1.00
IGL02150:Fcgbpl1 APN 7 27,846,204 (GRCm39) nonsense probably null
IGL02219:Fcgbpl1 APN 7 27,854,060 (GRCm39) missense probably damaging 1.00
IGL02563:Fcgbpl1 APN 7 27,857,317 (GRCm39) missense probably benign
IGL02804:Fcgbpl1 APN 7 27,852,795 (GRCm39) missense probably benign 0.00
IGL02830:Fcgbpl1 APN 7 27,862,348 (GRCm39) missense probably damaging 1.00
IGL02943:Fcgbpl1 APN 7 27,846,613 (GRCm39) missense probably damaging 1.00
IGL02977:Fcgbpl1 APN 7 27,863,797 (GRCm39) missense possibly damaging 0.83
IGL03231:Fcgbpl1 APN 7 27,853,147 (GRCm39) missense possibly damaging 0.95
IGL03304:Fcgbpl1 APN 7 27,841,667 (GRCm39) missense probably damaging 0.99
herz UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
pulse UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
Sinusoidal UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
PIT4378001:Fcgbpl1 UTSW 7 27,853,889 (GRCm39) missense possibly damaging 0.61
R0023:Fcgbpl1 UTSW 7 27,852,837 (GRCm39) missense probably benign 0.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0131:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0132:Fcgbpl1 UTSW 7 27,837,040 (GRCm39) missense probably damaging 1.00
R0158:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R0230:Fcgbpl1 UTSW 7 27,856,250 (GRCm39) missense probably damaging 1.00
R0310:Fcgbpl1 UTSW 7 27,841,699 (GRCm39) missense probably benign 0.04
R0448:Fcgbpl1 UTSW 7 27,839,660 (GRCm39) missense probably benign 0.03
R0462:Fcgbpl1 UTSW 7 27,836,765 (GRCm39) missense probably damaging 1.00
R0481:Fcgbpl1 UTSW 7 27,853,174 (GRCm39) missense probably damaging 1.00
R0497:Fcgbpl1 UTSW 7 27,846,890 (GRCm39) missense probably damaging 1.00
R0556:Fcgbpl1 UTSW 7 27,858,803 (GRCm39) missense probably benign
R0562:Fcgbpl1 UTSW 7 27,862,115 (GRCm39) missense probably benign 0.30
R0586:Fcgbpl1 UTSW 7 27,836,516 (GRCm39) missense probably damaging 0.99
R0924:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R0930:Fcgbpl1 UTSW 7 27,839,555 (GRCm39) missense probably damaging 1.00
R1103:Fcgbpl1 UTSW 7 27,853,945 (GRCm39) missense probably damaging 1.00
R1213:Fcgbpl1 UTSW 7 27,857,098 (GRCm39) missense probably damaging 1.00
R1292:Fcgbpl1 UTSW 7 27,842,219 (GRCm39) splice site probably benign
R1368:Fcgbpl1 UTSW 7 27,858,903 (GRCm39) missense possibly damaging 0.89
R1451:Fcgbpl1 UTSW 7 27,836,582 (GRCm39) missense probably damaging 1.00
R1477:Fcgbpl1 UTSW 7 27,856,518 (GRCm39) missense probably benign 0.01
R1538:Fcgbpl1 UTSW 7 27,854,917 (GRCm39) missense probably damaging 1.00
R1655:Fcgbpl1 UTSW 7 27,846,535 (GRCm39) missense probably damaging 0.98
R1697:Fcgbpl1 UTSW 7 27,853,772 (GRCm39) missense probably damaging 1.00
R1741:Fcgbpl1 UTSW 7 27,857,279 (GRCm39) missense probably damaging 0.98
R1796:Fcgbpl1 UTSW 7 27,854,797 (GRCm39) missense probably damaging 1.00
R1853:Fcgbpl1 UTSW 7 27,854,971 (GRCm39) nonsense probably null
R1861:Fcgbpl1 UTSW 7 27,854,157 (GRCm39) missense probably damaging 1.00
R1909:Fcgbpl1 UTSW 7 27,843,773 (GRCm39) missense possibly damaging 0.52
R1971:Fcgbpl1 UTSW 7 27,830,937 (GRCm39) missense possibly damaging 0.90
R1990:Fcgbpl1 UTSW 7 27,853,785 (GRCm39) missense probably damaging 0.98
R2020:Fcgbpl1 UTSW 7 27,855,019 (GRCm39) missense probably benign
R2084:Fcgbpl1 UTSW 7 27,856,960 (GRCm39) missense probably damaging 1.00
R2125:Fcgbpl1 UTSW 7 27,857,447 (GRCm39) missense probably benign 0.00
R2132:Fcgbpl1 UTSW 7 27,854,899 (GRCm39) missense probably damaging 1.00
R2513:Fcgbpl1 UTSW 7 27,831,060 (GRCm39) missense probably damaging 0.99
R2913:Fcgbpl1 UTSW 7 27,863,732 (GRCm39) missense probably damaging 1.00
R3150:Fcgbpl1 UTSW 7 27,853,620 (GRCm39) missense probably benign 0.21
R3499:Fcgbpl1 UTSW 7 27,853,980 (GRCm39) missense probably benign 0.42
R3702:Fcgbpl1 UTSW 7 27,857,203 (GRCm39) missense probably damaging 1.00
R3881:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R3938:Fcgbpl1 UTSW 7 27,853,719 (GRCm39) missense probably damaging 1.00
R4050:Fcgbpl1 UTSW 7 27,852,410 (GRCm39) missense possibly damaging 0.55
R4152:Fcgbpl1 UTSW 7 27,856,322 (GRCm39) missense possibly damaging 0.47
R4168:Fcgbpl1 UTSW 7 27,836,534 (GRCm39) missense probably benign 0.05
R4235:Fcgbpl1 UTSW 7 27,856,073 (GRCm39) missense probably damaging 0.99
R4241:Fcgbpl1 UTSW 7 27,853,760 (GRCm39) missense probably damaging 1.00
R4363:Fcgbpl1 UTSW 7 27,846,331 (GRCm39) missense probably damaging 1.00
R4460:Fcgbpl1 UTSW 7 27,852,281 (GRCm39) missense probably benign 0.17
R4463:Fcgbpl1 UTSW 7 27,850,144 (GRCm39) missense probably benign
R4841:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4842:Fcgbpl1 UTSW 7 27,850,147 (GRCm39) missense probably damaging 1.00
R4876:Fcgbpl1 UTSW 7 27,842,225 (GRCm39) intron probably benign
R4905:Fcgbpl1 UTSW 7 27,856,408 (GRCm39) missense possibly damaging 0.93
R4997:Fcgbpl1 UTSW 7 27,843,349 (GRCm39) missense possibly damaging 0.77
R5091:Fcgbpl1 UTSW 7 27,856,383 (GRCm39) missense probably benign 0.44
R5159:Fcgbpl1 UTSW 7 27,852,733 (GRCm39) missense probably benign 0.09
R5326:Fcgbpl1 UTSW 7 27,854,914 (GRCm39) missense probably damaging 0.98
R5396:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign
R5441:Fcgbpl1 UTSW 7 27,856,339 (GRCm39) missense probably damaging 1.00
R5480:Fcgbpl1 UTSW 7 27,857,424 (GRCm39) nonsense probably null
R5571:Fcgbpl1 UTSW 7 27,855,994 (GRCm39) missense probably damaging 0.99
R5613:Fcgbpl1 UTSW 7 27,842,303 (GRCm39) intron probably benign
R5637:Fcgbpl1 UTSW 7 27,852,277 (GRCm39) missense probably benign 0.00
R5766:Fcgbpl1 UTSW 7 27,836,754 (GRCm39) nonsense probably null
R6174:Fcgbpl1 UTSW 7 27,839,384 (GRCm39) missense probably damaging 0.96
R6233:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R6250:Fcgbpl1 UTSW 7 27,850,139 (GRCm39) missense probably damaging 1.00
R6379:Fcgbpl1 UTSW 7 27,857,017 (GRCm39) missense probably damaging 1.00
R6442:Fcgbpl1 UTSW 7 27,843,611 (GRCm39) missense possibly damaging 0.88
R6478:Fcgbpl1 UTSW 7 27,854,798 (GRCm39) missense probably damaging 1.00
R6699:Fcgbpl1 UTSW 7 27,843,793 (GRCm39) missense probably damaging 1.00
R6852:Fcgbpl1 UTSW 7 27,846,560 (GRCm39) missense probably damaging 1.00
R6883:Fcgbpl1 UTSW 7 27,852,260 (GRCm39) missense possibly damaging 0.89
R6902:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6903:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6904:Fcgbpl1 UTSW 7 27,836,638 (GRCm39) missense probably damaging 1.00
R6992:Fcgbpl1 UTSW 7 27,839,608 (GRCm39) missense probably benign 0.04
R7023:Fcgbpl1 UTSW 7 27,839,463 (GRCm39) nonsense probably null
R7039:Fcgbpl1 UTSW 7 27,839,573 (GRCm39) missense possibly damaging 0.80
R7171:Fcgbpl1 UTSW 7 27,853,944 (GRCm39) nonsense probably null
R7282:Fcgbpl1 UTSW 7 27,843,833 (GRCm39) missense probably benign 0.02
R7291:Fcgbpl1 UTSW 7 27,839,645 (GRCm39) missense probably benign
R7344:Fcgbpl1 UTSW 7 27,852,185 (GRCm39) missense possibly damaging 0.46
R7344:Fcgbpl1 UTSW 7 27,839,704 (GRCm39) missense possibly damaging 0.79
R7392:Fcgbpl1 UTSW 7 27,863,797 (GRCm39) missense possibly damaging 0.83
R7531:Fcgbpl1 UTSW 7 27,839,656 (GRCm39) missense probably benign
R7541:Fcgbpl1 UTSW 7 27,843,681 (GRCm39) nonsense probably null
R7577:Fcgbpl1 UTSW 7 27,853,848 (GRCm39) missense possibly damaging 0.65
R7594:Fcgbpl1 UTSW 7 27,830,885 (GRCm39) missense probably damaging 0.99
R7647:Fcgbpl1 UTSW 7 27,839,470 (GRCm39) missense probably benign 0.00
R7718:Fcgbpl1 UTSW 7 27,846,626 (GRCm39) missense probably damaging 1.00
R7733:Fcgbpl1 UTSW 7 27,839,390 (GRCm39) missense probably damaging 1.00
R7737:Fcgbpl1 UTSW 7 27,856,498 (GRCm39) missense probably damaging 1.00
R7908:Fcgbpl1 UTSW 7 27,846,921 (GRCm39) missense probably benign 0.12
R8013:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8014:Fcgbpl1 UTSW 7 27,836,966 (GRCm39) missense probably benign 0.14
R8151:Fcgbpl1 UTSW 7 27,852,766 (GRCm39) missense possibly damaging 0.95
R8175:Fcgbpl1 UTSW 7 27,863,873 (GRCm39) nonsense probably null
R8254:Fcgbpl1 UTSW 7 27,846,774 (GRCm39) missense possibly damaging 0.63
R8345:Fcgbpl1 UTSW 7 27,854,785 (GRCm39) missense probably damaging 1.00
R8414:Fcgbpl1 UTSW 7 27,842,158 (GRCm39) missense probably damaging 1.00
R8419:Fcgbpl1 UTSW 7 27,843,346 (GRCm39) missense probably damaging 1.00
R8496:Fcgbpl1 UTSW 7 27,843,377 (GRCm39) missense possibly damaging 0.81
R8691:Fcgbpl1 UTSW 7 27,853,264 (GRCm39) missense possibly damaging 0.72
R8785:Fcgbpl1 UTSW 7 27,854,132 (GRCm39) missense probably damaging 1.00
R8863:Fcgbpl1 UTSW 7 27,831,006 (GRCm39) missense probably damaging 1.00
R8926:Fcgbpl1 UTSW 7 27,853,869 (GRCm39) missense probably damaging 1.00
R8950:Fcgbpl1 UTSW 7 27,863,751 (GRCm39) missense probably benign 0.32
R9014:Fcgbpl1 UTSW 7 27,854,876 (GRCm39) missense probably damaging 1.00
R9045:Fcgbpl1 UTSW 7 27,853,856 (GRCm39) missense probably damaging 1.00
R9115:Fcgbpl1 UTSW 7 27,853,754 (GRCm39) missense possibly damaging 0.74
R9233:Fcgbpl1 UTSW 7 27,839,519 (GRCm39) missense possibly damaging 0.83
R9330:Fcgbpl1 UTSW 7 27,856,410 (GRCm39) missense probably benign 0.02
R9426:Fcgbpl1 UTSW 7 27,843,281 (GRCm39) missense possibly damaging 0.92
R9477:Fcgbpl1 UTSW 7 27,852,265 (GRCm39) missense probably damaging 1.00
R9502:Fcgbpl1 UTSW 7 27,836,891 (GRCm39) missense probably benign 0.09
R9505:Fcgbpl1 UTSW 7 27,841,909 (GRCm39) nonsense probably null
R9601:Fcgbpl1 UTSW 7 27,853,805 (GRCm39) missense possibly damaging 0.78
R9630:Fcgbpl1 UTSW 7 27,836,624 (GRCm39) missense probably damaging 1.00
R9632:Fcgbpl1 UTSW 7 27,841,726 (GRCm39) missense probably benign
R9673:Fcgbpl1 UTSW 7 27,856,044 (GRCm39) missense probably benign 0.25
R9735:Fcgbpl1 UTSW 7 27,856,435 (GRCm39) missense probably damaging 1.00
Z1176:Fcgbpl1 UTSW 7 27,854,187 (GRCm39) missense probably benign 0.03
Z1176:Fcgbpl1 UTSW 7 27,841,811 (GRCm39) missense probably benign 0.06
Z1177:Fcgbpl1 UTSW 7 27,839,323 (GRCm39) missense probably benign 0.25
Z1186:Fcgbpl1 UTSW 7 27,856,411 (GRCm39) missense probably benign 0.01
Z1186:Fcgbpl1 UTSW 7 27,846,130 (GRCm39) missense probably benign 0.00
Z1186:Fcgbpl1 UTSW 7 27,830,997 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCGGCAACTACAACAAG -3'
(R):5'- TTATGGAGCTACATGGGTCAGTAC -3'

Sequencing Primer
(F):5'- GAATCCCAACGATGACCTGACTG -3'
(R):5'- AGCTACATGGGTCAGTACTCACG -3'
Posted On 2016-10-24