Incidental Mutation 'R5543:Prrc2c'
ID436075
Institutional Source Beutler Lab
Gene Symbol Prrc2c
Ensembl Gene ENSMUSG00000040225
Gene Nameproline-rich coiled-coil 2C
Synonyms9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.325) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location162670725-162740556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 162673511 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1241 (P1241L)
Ref Sequence ENSEMBL: ENSMUSP00000138698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028016] [ENSMUST00000182149] [ENSMUST00000182393] [ENSMUST00000182593] [ENSMUST00000182660] [ENSMUST00000183223]
Predicted Effect probably benign
Transcript: ENSMUST00000028016
AA Change: P2809L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000028016
Gene: ENSMUSG00000040225
AA Change: P2809L

DomainStartEndE-ValueType
Pfam:BAT2_N 1 164 7.7e-56 PFAM
internal_repeat_2 167 349 4.39e-5 PROSPERO
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182149
SMART Domains Protein: ENSMUSP00000138548
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 5.6e-73 PFAM
internal_repeat_1 336 391 1.49e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
internal_repeat_3 754 925 9.16e-5 PROSPERO
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 1.49e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 3.08e-5 PROSPERO
internal_repeat_3 1983 2153 9.16e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182393
SMART Domains Protein: ENSMUSP00000138451
Gene: ENSMUSG00000040225

DomainStartEndE-ValueType
low complexity region 24 51 N/A INTRINSIC
low complexity region 104 125 N/A INTRINSIC
low complexity region 431 462 N/A INTRINSIC
low complexity region 481 519 N/A INTRINSIC
low complexity region 531 548 N/A INTRINSIC
low complexity region 560 625 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 946 968 N/A INTRINSIC
low complexity region 988 1002 N/A INTRINSIC
low complexity region 1037 1054 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
low complexity region 1274 1297 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182593
AA Change: P2730L

PolyPhen 2 Score 0.130 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138674
Gene: ENSMUSG00000040225
AA Change: P2730L

DomainStartEndE-ValueType
Pfam:BAT2_N 1 165 4.1e-70 PFAM
internal_repeat_1 334 389 9.57e-6 PROSPERO
low complexity region 405 412 N/A INTRINSIC
SCOP:d1eq1a_ 445 589 3e-5 SMART
low complexity region 647 667 N/A INTRINSIC
low complexity region 731 743 N/A INTRINSIC
internal_repeat_3 752 923 6.11e-5 PROSPERO
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1155 1184 N/A INTRINSIC
low complexity region 1210 1220 N/A INTRINSIC
internal_repeat_1 1238 1293 9.57e-6 PROSPERO
low complexity region 1306 1333 N/A INTRINSIC
low complexity region 1386 1407 N/A INTRINSIC
low complexity region 1713 1744 N/A INTRINSIC
low complexity region 1763 1801 N/A INTRINSIC
low complexity region 1813 1830 N/A INTRINSIC
low complexity region 1842 1907 N/A INTRINSIC
internal_repeat_2 1960 2146 2.01e-5 PROSPERO
internal_repeat_3 1981 2151 6.11e-5 PROSPERO
low complexity region 2161 2175 N/A INTRINSIC
low complexity region 2228 2250 N/A INTRINSIC
low complexity region 2270 2284 N/A INTRINSIC
low complexity region 2319 2336 N/A INTRINSIC
low complexity region 2425 2436 N/A INTRINSIC
low complexity region 2551 2574 N/A INTRINSIC
low complexity region 2671 2682 N/A INTRINSIC
low complexity region 2730 2747 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182660
AA Change: P2811L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138433
Gene: ENSMUSG00000040225
AA Change: P2811L

DomainStartEndE-ValueType
Pfam:BAT2_N 1 167 7e-73 PFAM
internal_repeat_1 336 391 2.14e-5 PROSPERO
low complexity region 407 414 N/A INTRINSIC
SCOP:d1eq1a_ 447 591 2e-5 SMART
low complexity region 649 669 N/A INTRINSIC
low complexity region 733 745 N/A INTRINSIC
coiled coil region 996 1026 N/A INTRINSIC
low complexity region 1157 1186 N/A INTRINSIC
low complexity region 1212 1222 N/A INTRINSIC
internal_repeat_1 1240 1295 2.14e-5 PROSPERO
low complexity region 1308 1335 N/A INTRINSIC
low complexity region 1388 1409 N/A INTRINSIC
low complexity region 1715 1746 N/A INTRINSIC
low complexity region 1765 1803 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1844 1909 N/A INTRINSIC
internal_repeat_2 1962 2148 4.39e-5 PROSPERO
low complexity region 2163 2177 N/A INTRINSIC
low complexity region 2230 2252 N/A INTRINSIC
low complexity region 2272 2286 N/A INTRINSIC
low complexity region 2321 2338 N/A INTRINSIC
low complexity region 2427 2438 N/A INTRINSIC
low complexity region 2553 2576 N/A INTRINSIC
low complexity region 2811 2828 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183223
AA Change: P1241L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138698
Gene: ENSMUSG00000040225
AA Change: P1241L

DomainStartEndE-ValueType
low complexity region 289 320 N/A INTRINSIC
low complexity region 339 377 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 418 483 N/A INTRINSIC
low complexity region 739 761 N/A INTRINSIC
low complexity region 781 795 N/A INTRINSIC
low complexity region 830 847 N/A INTRINSIC
low complexity region 936 947 N/A INTRINSIC
low complexity region 1062 1085 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1241 1258 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184547
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Prrc2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Prrc2c APN 1 162720613 splice site probably null
IGL00577:Prrc2c APN 1 162698116 missense unknown
IGL00580:Prrc2c APN 1 162698116 missense unknown
IGL01295:Prrc2c APN 1 162682492 missense probably damaging 1.00
IGL01554:Prrc2c APN 1 162710786 missense probably damaging 0.99
IGL01684:Prrc2c APN 1 162706462 unclassified probably benign
IGL01745:Prrc2c APN 1 162724728 missense probably damaging 1.00
IGL01770:Prrc2c APN 1 162704499 missense probably benign 0.23
IGL01905:Prrc2c APN 1 162705329 unclassified probably benign
IGL02304:Prrc2c APN 1 162684136 missense probably benign 0.05
IGL02389:Prrc2c APN 1 162692870 missense probably damaging 1.00
IGL02540:Prrc2c APN 1 162723137 missense probably damaging 1.00
IGL02681:Prrc2c APN 1 162705612 unclassified probably benign
IGL02686:Prrc2c APN 1 162707947 unclassified probably benign
IGL02795:Prrc2c APN 1 162714299 missense probably benign
IGL02894:Prrc2c APN 1 162678057 missense probably damaging 1.00
IGL02957:Prrc2c APN 1 162706535 unclassified probably benign
IGL02981:Prrc2c APN 1 162705179 unclassified probably benign
IGL03070:Prrc2c APN 1 162677409 missense probably damaging 1.00
IGL03096:Prrc2c APN 1 162702359 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0058:Prrc2c UTSW 1 162698884 missense unknown
R0135:Prrc2c UTSW 1 162715483 splice site probably benign
R0279:Prrc2c UTSW 1 162715464 missense probably damaging 1.00
R0363:Prrc2c UTSW 1 162697811 missense unknown
R0436:Prrc2c UTSW 1 162705314 unclassified probably benign
R0605:Prrc2c UTSW 1 162682426 missense probably damaging 1.00
R0696:Prrc2c UTSW 1 162708852 critical splice donor site probably null
R0981:Prrc2c UTSW 1 162705981 unclassified probably benign
R1693:Prrc2c UTSW 1 162718713 missense probably damaging 0.98
R1714:Prrc2c UTSW 1 162677376 missense probably damaging 1.00
R1791:Prrc2c UTSW 1 162704982 unclassified probably benign
R1794:Prrc2c UTSW 1 162705959 unclassified probably benign
R1998:Prrc2c UTSW 1 162704918 unclassified probably benign
R2040:Prrc2c UTSW 1 162697557 missense probably damaging 1.00
R2168:Prrc2c UTSW 1 162710334 unclassified probably benign
R2246:Prrc2c UTSW 1 162707791 unclassified probably benign
R2830:Prrc2c UTSW 1 162708916 unclassified probably benign
R2926:Prrc2c UTSW 1 162706127 unclassified probably benign
R3703:Prrc2c UTSW 1 162710691 missense probably damaging 1.00
R3745:Prrc2c UTSW 1 162698185 missense unknown
R3760:Prrc2c UTSW 1 162692851 missense probably damaging 1.00
R3784:Prrc2c UTSW 1 162709669 unclassified probably benign
R3959:Prrc2c UTSW 1 162708892 unclassified probably benign
R4255:Prrc2c UTSW 1 162706326 unclassified probably benign
R4276:Prrc2c UTSW 1 162673591 missense probably damaging 1.00
R4421:Prrc2c UTSW 1 162709061 unclassified probably benign
R4593:Prrc2c UTSW 1 162697532 missense probably damaging 1.00
R4651:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4652:Prrc2c UTSW 1 162723274 missense probably damaging 1.00
R4660:Prrc2c UTSW 1 162680895 missense probably damaging 1.00
R4677:Prrc2c UTSW 1 162705179 unclassified probably benign
R4688:Prrc2c UTSW 1 162697687 missense unknown
R4753:Prrc2c UTSW 1 162691230 missense probably damaging 1.00
R4790:Prrc2c UTSW 1 162710481 missense unknown
R4981:Prrc2c UTSW 1 162692547 missense probably damaging 1.00
R4995:Prrc2c UTSW 1 162705310 unclassified probably benign
R5119:Prrc2c UTSW 1 162705440 unclassified probably benign
R5127:Prrc2c UTSW 1 162697846 missense unknown
R5291:Prrc2c UTSW 1 162705582 unclassified probably benign
R5474:Prrc2c UTSW 1 162709644 unclassified probably benign
R5579:Prrc2c UTSW 1 162680758 critical splice donor site probably null
R5594:Prrc2c UTSW 1 162699031 missense unknown
R5620:Prrc2c UTSW 1 162673529 missense probably damaging 1.00
R5994:Prrc2c UTSW 1 162674156 splice site probably null
R6142:Prrc2c UTSW 1 162710387 missense unknown
R6199:Prrc2c UTSW 1 162682516 missense probably damaging 1.00
R6277:Prrc2c UTSW 1 162714314 missense probably benign
R6504:Prrc2c UTSW 1 162697795 missense unknown
R6671:Prrc2c UTSW 1 162697585 missense probably damaging 1.00
R6785:Prrc2c UTSW 1 162709101 unclassified probably benign
R6799:Prrc2c UTSW 1 162709061 unclassified probably benign
R6801:Prrc2c UTSW 1 162709061 unclassified probably benign
R6850:Prrc2c UTSW 1 162709061 unclassified probably benign
R6851:Prrc2c UTSW 1 162709061 unclassified probably benign
R6856:Prrc2c UTSW 1 162682371 missense probably damaging 1.00
R6869:Prrc2c UTSW 1 162709061 unclassified probably benign
R6882:Prrc2c UTSW 1 162709061 unclassified probably benign
R6884:Prrc2c UTSW 1 162709061 unclassified probably benign
R6897:Prrc2c UTSW 1 162705506 unclassified probably benign
R6934:Prrc2c UTSW 1 162720505 missense probably benign 0.10
R6976:Prrc2c UTSW 1 162692844 missense probably damaging 1.00
R7132:Prrc2c UTSW 1 162681281 missense possibly damaging 0.77
R7165:Prrc2c UTSW 1 162673517 missense possibly damaging 0.94
R7282:Prrc2c UTSW 1 162679974 missense possibly damaging 0.59
R7467:Prrc2c UTSW 1 162677363 missense possibly damaging 0.84
R8068:Prrc2c UTSW 1 162709061 unclassified probably benign
X0020:Prrc2c UTSW 1 162707847 unclassified probably benign
X0039:Prrc2c UTSW 1 162704793 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAGACCACTTTACCCCTGTG -3'
(R):5'- ACTGAGATTGATTTGACAGGCTTTG -3'

Sequencing Primer
(F):5'- TTACCCCTGTGGCTGCTGG -3'
(R):5'- AGGTAATGTTGCAGTGCTTTCAG -3'
Posted On2016-10-24