Incidental Mutation 'R5543:Acvr1'
ID436078
Institutional Source Beutler Lab
Gene Symbol Acvr1
Ensembl Gene ENSMUSG00000026836
Gene Nameactivin A receptor, type 1
SynonymsAlk-2, ActR-I, Acvrlk2, SKR1, ALK2, Tsk7L, D330013D15Rik, Acvr, ActRIA, Alk8
MMRRC Submission 043101-MU
Accession Numbers

Genbank: NM_007394; MGI: 87911

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location58388644-58567157 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58463145 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 268 (S268P)
Ref Sequence ENSEMBL: ENSMUSP00000108220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056376] [ENSMUST00000090935] [ENSMUST00000112599] [ENSMUST00000112601]
Predicted Effect probably damaging
Transcript: ENSMUST00000056376
AA Change: S268P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056784
Gene: ENSMUSG00000026836
AA Change: S268P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000090935
AA Change: S268P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088453
Gene: ENSMUSG00000026836
AA Change: S268P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112599
AA Change: S268P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108218
Gene: ENSMUSG00000026836
AA Change: S268P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 1.4e-13 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112601
AA Change: S268P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108220
Gene: ENSMUSG00000026836
AA Change: S268P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Activin_recp 33 107 4e-14 PFAM
transmembrane domain 124 146 N/A INTRINSIC
GS 178 208 5.13e-16 SMART
Blast:STYKc 212 501 1e-25 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145495
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I ( I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. This gene encodes activin A type I receptor which signals a particular transcriptional response in concert with activin type II receptors. Mutations in this gene are associated with fibrodysplasia ossificans progressive. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth arrest and complete embryonic lethality due to gastrulation defects associated with abnormalities in primitive streak formation, embryonic epiblast morphology, and mesoderm and ectoderm development. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(3) Gene trapped(5)

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Acvr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Acvr1 APN 2 58447573 missense probably benign 0.00
IGL01392:Acvr1 APN 2 58500546 missense probably benign 0.01
IGL01526:Acvr1 APN 2 58458985 missense probably benign 0.20
IGL02524:Acvr1 APN 2 58448307 splice site probably benign
IGL02682:Acvr1 APN 2 58477811 missense probably benign 0.00
IGL02795:Acvr1 APN 2 58462952 missense probably damaging 1.00
R0084:Acvr1 UTSW 2 58458883 critical splice donor site probably null
R0452:Acvr1 UTSW 2 58500495 missense probably benign 0.13
R0746:Acvr1 UTSW 2 58500550 start codon destroyed probably null 0.01
R1484:Acvr1 UTSW 2 58479889 missense probably damaging 1.00
R1514:Acvr1 UTSW 2 58447585 nonsense probably null
R1645:Acvr1 UTSW 2 58462899 missense probably damaging 1.00
R1925:Acvr1 UTSW 2 58447649 missense probably damaging 0.99
R2435:Acvr1 UTSW 2 58479692 missense probably damaging 1.00
R2873:Acvr1 UTSW 2 58477796 nonsense probably null
R3729:Acvr1 UTSW 2 58462913 missense probably null 0.09
R3854:Acvr1 UTSW 2 58462934 missense probably damaging 1.00
R4438:Acvr1 UTSW 2 58477727 missense probably benign 0.00
R4863:Acvr1 UTSW 2 58477711 missense possibly damaging 0.60
R5558:Acvr1 UTSW 2 58459017 missense probably damaging 1.00
R5618:Acvr1 UTSW 2 58462943 missense probably damaging 1.00
R6233:Acvr1 UTSW 2 58448399 missense probably benign 0.04
R6236:Acvr1 UTSW 2 58477666 missense probably benign 0.17
R6565:Acvr1 UTSW 2 58479757 missense probably damaging 1.00
R6912:Acvr1 UTSW 2 58447573 missense probably benign 0.00
R7739:Acvr1 UTSW 2 58462971 missense possibly damaging 0.47
R7912:Acvr1 UTSW 2 58474218 missense probably damaging 0.97
R7993:Acvr1 UTSW 2 58474218 missense probably damaging 0.97
Z1176:Acvr1 UTSW 2 58479868 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGATCTCGATGGGCAATGG -3'
(R):5'- AAACTGGAGGGTCATGTGCTG -3'

Sequencing Primer
(F):5'- AATGGCGGACTTCCCTTG -3'
(R):5'- GTTCGTTGGCCCTGCAC -3'
Posted On2016-10-24