Incidental Mutation 'R5543:Olfr1024'
ID436081
Institutional Source Beutler Lab
Gene Symbol Olfr1024
Ensembl Gene ENSMUSG00000075206
Gene Nameolfactory receptor 1024
SynonymsGA_x6K02T2Q125-47384320-47383337, MOR197-1
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85904069-85905052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85904328 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 242 (A242D)
Ref Sequence ENSEMBL: ENSMUSP00000097496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099912]
Predicted Effect probably damaging
Transcript: ENSMUST00000099912
AA Change: A242D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097496
Gene: ENSMUSG00000075206
AA Change: A242D

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 7.6e-52 PFAM
Pfam:7tm_1 46 295 4.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215677
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Olfr1024
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Olfr1024 APN 2 85904370 missense probably benign
IGL02108:Olfr1024 APN 2 85904150 missense possibly damaging 0.67
IGL02738:Olfr1024 APN 2 85904949 missense probably benign 0.06
IGL03343:Olfr1024 APN 2 85904941 missense probably benign
IGL02802:Olfr1024 UTSW 2 85904389 missense probably damaging 1.00
R0265:Olfr1024 UTSW 2 85904247 missense probably benign 0.01
R0271:Olfr1024 UTSW 2 85904289 missense possibly damaging 0.68
R0432:Olfr1024 UTSW 2 85904157 missense probably damaging 1.00
R0501:Olfr1024 UTSW 2 85905004 missense probably damaging 1.00
R0504:Olfr1024 UTSW 2 85904686 missense possibly damaging 0.95
R1513:Olfr1024 UTSW 2 85904671 missense probably damaging 1.00
R2224:Olfr1024 UTSW 2 85904755 missense probably benign 0.11
R2516:Olfr1024 UTSW 2 85904556 missense probably benign 0.01
R3845:Olfr1024 UTSW 2 85904737 missense probably damaging 0.99
R4871:Olfr1024 UTSW 2 85904371 missense probably benign
R4889:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R4890:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R5865:Olfr1024 UTSW 2 85904521 missense probably benign 0.00
R6254:Olfr1024 UTSW 2 85904505 missense probably damaging 1.00
R6331:Olfr1024 UTSW 2 85904216 missense probably benign 0.32
R6465:Olfr1024 UTSW 2 85904539 missense probably benign 0.05
R7183:Olfr1024 UTSW 2 85904142 missense probably benign 0.00
R7427:Olfr1024 UTSW 2 85904131 nonsense probably null
R7428:Olfr1024 UTSW 2 85904131 nonsense probably null
R7552:Olfr1024 UTSW 2 85904103 missense probably benign 0.01
R7654:Olfr1024 UTSW 2 85904319 missense possibly damaging 0.95
R7674:Olfr1024 UTSW 2 85904536 missense probably damaging 1.00
Z1177:Olfr1024 UTSW 2 85905045 missense not run
Predicted Primers PCR Primer
(F):5'- CAGAGCCTGCTTCACATCCTTG -3'
(R):5'- TTTGTGGACCCAACACCATC -3'

Sequencing Primer
(F):5'- CTTGTTTCTCAGGCTGTAGATAAATG -3'
(R):5'- AACCACTTCTACTGTGCTGAC -3'
Posted On2016-10-24