Incidental Mutation 'R5543:Hrh3'
ID436082
Institutional Source Beutler Lab
Gene Symbol Hrh3
Ensembl Gene ENSMUSG00000039059
Gene Namehistamine receptor H3
Synonyms
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R5543 (G1)
Quality Score97
Status Not validated
Chromosome2
Chromosomal Location180099465-180104488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 180103970 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 61 (A61E)
Ref Sequence ENSEMBL: ENSMUSP00000127085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056480] [ENSMUST00000163215] [ENSMUST00000164442] [ENSMUST00000165248] [ENSMUST00000165762] [ENSMUST00000166724] [ENSMUST00000171736]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056480
AA Change: A61E

PolyPhen 2 Score 0.589 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049963
Gene: ENSMUSG00000039059
AA Change: A61E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 7.2e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163215
AA Change: A61E

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127053
Gene: ENSMUSG00000039059
AA Change: A61E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 376 2e-55 PFAM
low complexity region 406 415 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164442
AA Change: A61E

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130553
Gene: ENSMUSG00000039059
AA Change: A61E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 380 4.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165248
AA Change: A61E

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130181
Gene: ENSMUSG00000039059
AA Change: A61E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 364 6.9e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165762
AA Change: A61E

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132203
Gene: ENSMUSG00000039059
AA Change: A61E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 412 1.3e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166392
Predicted Effect unknown
Transcript: ENSMUST00000166724
AA Change: A61E
SMART Domains Protein: ENSMUSP00000126336
Gene: ENSMUSG00000039059
AA Change: A61E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 93 1.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171736
AA Change: A61E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000127085
Gene: ENSMUSG00000039059
AA Change: A61E

DomainStartEndE-ValueType
low complexity region 12 50 N/A INTRINSIC
Pfam:7tm_1 51 239 5.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172211
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. This gene encodes one of the histamine receptors (H3) which belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and can regulate neurotransmitter release. This receptor can also increase voltage-dependent calcium current in smooth muscles and innervates the blood vessels and the heart in cardiovascular system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced locomotor activity and body temperature, and attenuated behavioral responses to the drugs thioperamide, methamphetamine, and scopolamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Hrh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Hrh3 APN 2 180101103 missense possibly damaging 0.69
IGL01827:Hrh3 APN 2 180103946 missense possibly damaging 0.95
IGL01912:Hrh3 APN 2 180101376 missense probably damaging 1.00
IGL02992:Hrh3 APN 2 180100815 missense probably benign 0.11
IGL03273:Hrh3 APN 2 180100648 missense possibly damaging 0.85
R1403:Hrh3 UTSW 2 180102754 missense probably damaging 1.00
R1403:Hrh3 UTSW 2 180102754 missense probably damaging 1.00
R1808:Hrh3 UTSW 2 180099784 unclassified probably benign
R2060:Hrh3 UTSW 2 180101250 missense possibly damaging 0.95
R4110:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4111:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4113:Hrh3 UTSW 2 180102850 missense possibly damaging 0.84
R4330:Hrh3 UTSW 2 180099872 unclassified probably benign
R4935:Hrh3 UTSW 2 180101268 missense probably damaging 1.00
R5050:Hrh3 UTSW 2 180100557 missense probably damaging 1.00
R5780:Hrh3 UTSW 2 180100815 missense probably damaging 0.96
R7571:Hrh3 UTSW 2 180101286 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTTTCTAGAGCTCCTCTCCCAAG -3'
(R):5'- CCGGCAAAGATTAGGCTCAAG -3'

Sequencing Primer
(F):5'- AGGCCGAACCCCTGAGAAG -3'
(R):5'- AGCCCTGTGAGCCTGCTG -3'
Posted On2016-10-24