Incidental Mutation 'R5543:Ccne2'
ID436083
Institutional Source Beutler Lab
Gene Symbol Ccne2
Ensembl Gene ENSMUSG00000028212
Gene Namecyclin E2
Synonyms
MMRRC Submission 043101-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location11191351-11204779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 11194026 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 89 (N89I)
Ref Sequence ENSEMBL: ENSMUSP00000130693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029866] [ENSMUST00000108324] [ENSMUST00000170901]
Predicted Effect probably benign
Transcript: ENSMUST00000029866
AA Change: N88I

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000029866
Gene: ENSMUSG00000028212
AA Change: N88I

DomainStartEndE-ValueType
CYCLIN 146 231 2.16e-24 SMART
Cyclin_C 240 362 5.49e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108324
AA Change: N89I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103960
Gene: ENSMUSG00000028212
AA Change: N89I

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145430
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149075
Predicted Effect probably benign
Transcript: ENSMUST00000170901
AA Change: N89I

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130693
Gene: ENSMUSG00000028212
AA Change: N89I

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for disruptions in this gene are phenotypically normal. Male mice show reduced fertility but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Ptprd T C 4: 76,059,753 E173G probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Ccne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Ccne2 APN 4 11199322 missense probably benign 0.01
IGL02207:Ccne2 APN 4 11202261 missense probably benign 0.00
IGL02885:Ccne2 APN 4 11198723 splice site probably benign
R0367:Ccne2 UTSW 4 11201426 splice site probably benign
R0686:Ccne2 UTSW 4 11197220 missense possibly damaging 0.93
R1056:Ccne2 UTSW 4 11192707 missense probably damaging 0.99
R1068:Ccne2 UTSW 4 11192850 missense probably benign
R2076:Ccne2 UTSW 4 11197177 missense probably damaging 1.00
R2167:Ccne2 UTSW 4 11197249 missense probably benign 0.00
R2190:Ccne2 UTSW 4 11197241 missense probably benign 0.02
R3724:Ccne2 UTSW 4 11203039 missense probably benign 0.09
R3766:Ccne2 UTSW 4 11199293 splice site probably benign
R4595:Ccne2 UTSW 4 11202986 missense probably benign
R5469:Ccne2 UTSW 4 11201353 nonsense probably null
R5884:Ccne2 UTSW 4 11199411 missense probably benign 0.00
R6298:Ccne2 UTSW 4 11199306 missense probably damaging 1.00
R7493:Ccne2 UTSW 4 11198772 missense probably damaging 1.00
R7553:Ccne2 UTSW 4 11201348 missense probably benign 0.02
R7591:Ccne2 UTSW 4 11201393 missense probably benign
R7801:Ccne2 UTSW 4 11194079 critical splice donor site probably null
R7996:Ccne2 UTSW 4 11201347 missense not run
Predicted Primers PCR Primer
(F):5'- CCAGGCTTCGTTATCTAACTTAAGAAG -3'
(R):5'- AGTAGTTCAGTTCTGCTATGTCTAG -3'

Sequencing Primer
(F):5'- TCTACAGAGTGAGTTCCAGGAC -3'
(R):5'- AGAAAATACCTGGCATTGC -3'
Posted On2016-10-24