Mutagenetix > Incidental Mutations

Incidental Mutation 'R5543:Ptprd'

436084

Institutional Source

Beutler Lab

Gene Symbol

Ptprd

Ensembl Gene

ENSMUSG00000028399

Gene Name

protein tyrosine phosphatase, receptor type, D

Synonyms

1110002J03Rik, 3000002J10Rik, B230219D21Rik

MMRRC Submission

043101-MU

Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5543 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75941238-78211961 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76059753 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 173 (E173G)

Ref Sequence

ENSEMBL: ENSMUSP00000148560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831] [ENSMUST00000212365]

Predicted Effect

probably damaging
Transcript: ENSMUST00000050757
AA Change: E843G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399
AA Change: E843G

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	208	1.38e-15	SMART
IGc2	238	299	8.13e-4	SMART
FN3	313	392	7.92e-14	SMART
FN3	408	491	5.73e-11	SMART
IG_like	499	593	8.34e1	SMART
FN3	506	584	9.1e-14	SMART
FN3	597	674	1.21e0	SMART
transmembrane domain	847	869	N/A	INTRINSIC
low complexity region	870	882	N/A	INTRINSIC
PTPc	949	1207	6.38e-134	SMART
PTPc	1236	1498	9.17e-135	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098005
AA Change: E853G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399
AA Change: E853G

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	607	684	1.21e0	SMART
transmembrane domain	857	879	N/A	INTRINSIC
low complexity region	886	897	N/A	INTRINSIC
PTPc	950	1208	6.38e-134	SMART
PTPc	1237	1499	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102834
AA Change: E606G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399
AA Change: E606G

Domain	Start	End	E-Value	Type
IGc2	1	62	8.13e-4	SMART
FN3	76	155	7.92e-14	SMART
FN3	171	254	5.73e-11	SMART
IG_like	262	356	8.34e1	SMART
FN3	269	347	9.1e-14	SMART
FN3	360	437	1.21e0	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	633	645	N/A	INTRINSIC
PTPc	698	956	6.38e-134	SMART
PTPc	985	1247	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107289
AA Change: E1264G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399
AA Change: E1264G

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	609	696	2.72e-12	SMART
FN3	712	809	2.87e-11	SMART
FN3	824	904	4.96e-6	SMART
FN3	919	1003	4.12e-12	SMART
FN3	1018	1095	1.95e0	SMART
transmembrane domain	1268	1290	N/A	INTRINSIC
low complexity region	1291	1303	N/A	INTRINSIC
PTPc	1356	1614	6.38e-134	SMART
PTPc	1643	1905	9.17e-135	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173376
AA Change: E860G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399
AA Change: E860G

Domain	Start	End	E-Value	Type
IGc2	43	112	8.57e-12	SMART
IGc2	145	221	8.5e-16	SMART
low complexity region	232	244	N/A	INTRINSIC
IGc2	255	316	8.13e-4	SMART
FN3	330	409	7.92e-14	SMART
FN3	425	508	5.73e-11	SMART
IG_like	516	610	8.34e1	SMART
FN3	523	601	9.1e-14	SMART
FN3	614	691	1.21e0	SMART
transmembrane domain	864	886	N/A	INTRINSIC
low complexity region	887	899	N/A	INTRINSIC
PTPc	952	1210	6.38e-134	SMART
PTPc	1239	1501	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174023
AA Change: E850G

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399
AA Change: E850G

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	211	4.88e-16	SMART
low complexity region	222	234	N/A	INTRINSIC
IGc2	245	306	8.13e-4	SMART
FN3	320	399	7.92e-14	SMART
FN3	415	498	5.73e-11	SMART
IG_like	506	600	8.34e1	SMART
FN3	513	591	9.1e-14	SMART
FN3	604	681	1.21e0	SMART
transmembrane domain	853	875	N/A	INTRINSIC
low complexity region	882	893	N/A	INTRINSIC
PTPc	946	1204	6.38e-134	SMART
PTPc	1233	1495	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174180
AA Change: E1242G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399
AA Change: E1242G

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	205	2.09e-15	SMART
IGc2	235	296	8.13e-4	SMART
FN3	310	389	7.92e-14	SMART
FN3	405	488	5.73e-11	SMART
IG_like	496	590	8.34e1	SMART
FN3	503	581	9.1e-14	SMART
FN3	596	683	2.72e-12	SMART
FN3	699	787	6.15e-11	SMART
FN3	802	882	4.96e-6	SMART
FN3	897	981	4.12e-12	SMART
FN3	996	1073	1.95e0	SMART
transmembrane domain	1246	1268	N/A	INTRINSIC
low complexity region	1269	1281	N/A	INTRINSIC
PTPc	1334	1592	6.38e-134	SMART
PTPc	1621	1883	9.17e-135	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000174531
AA Change: E847G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399
AA Change: E847G

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	208	1.38e-15	SMART
low complexity region	219	231	N/A	INTRINSIC
IGc2	242	303	8.13e-4	SMART
FN3	317	396	7.92e-14	SMART
FN3	412	495	5.73e-11	SMART
IG_like	503	597	8.34e1	SMART
FN3	510	588	9.1e-14	SMART
FN3	601	678	1.21e0	SMART
transmembrane domain	851	873	N/A	INTRINSIC
low complexity region	874	886	N/A	INTRINSIC
PTPc	939	1197	6.38e-134	SMART
PTPc	1226	1488	9.17e-135	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000174831
AA Change: E853G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399
AA Change: E853G

Domain	Start	End	E-Value	Type
IGc2	36	105	8.57e-12	SMART
IGc2	138	214	8.5e-16	SMART
low complexity region	225	237	N/A	INTRINSIC
IGc2	248	309	8.13e-4	SMART
FN3	323	402	7.92e-14	SMART
FN3	418	501	5.73e-11	SMART
IG_like	509	603	8.34e1	SMART
FN3	516	594	9.1e-14	SMART
FN3	607	684	1.21e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	885	896	N/A	INTRINSIC
PTPc	949	1207	6.38e-134	SMART
PTPc	1236	1498	9.17e-135	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000212365
AA Change: E173G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.7%

Validation Efficiency

MGI Phenotype

Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	C	A	7: 128,237,181	S80I	probably benign	Het
Aak1	T	C	6: 86,982,645		probably null	Het
Abcc6	A	G	7: 45,989,536		probably null	Het
Acvr1	A	G	2: 58,463,145	S268P	probably damaging	Het
Apod	T	C	16: 31,303,533		probably null	Het
Atp5o	T	C	16: 91,926,530	I58V	probably benign	Het
AU040320	C	T	4: 126,841,224	T777M	probably damaging	Het
BC067074	C	A	13: 113,320,873	T1151K	probably damaging	Het
Ccne2	A	T	4: 11,194,026	N89I	probably benign	Het
Dnah7a	A	G	1: 53,504,069	V2314A	probably damaging	Het
Dopey2	T	C	16: 93,798,920	S1881P	probably damaging	Het
E4f1	A	G	17: 24,447,362	V24A	possibly damaging	Het
Esrrg	A	T	1: 188,150,254	D236V	probably damaging	Het
Fam240b	T	A	13: 64,485,922	I27F	possibly damaging	Het
Fat1	T	A	8: 45,023,479	I1854N	probably damaging	Het
Fchsd2	T	C	7: 101,271,699	Y480H	probably damaging	Het
Fras1	A	G	5: 96,528,535	N47S	probably benign	Het
Gabrr3	T	C	16: 59,433,507	S196P	probably damaging	Het
Gbp8	T	A	5: 105,017,830	D319V	possibly damaging	Het
Hrh3	G	T	2: 180,103,970	A61E	probably damaging	Het
Idua	T	C	5: 108,670,229	I89T	probably benign	Het
Ifitm3	T	A	7: 141,009,817	I108F	unknown	Het
Izumo4	T	C	10: 80,702,834	F40S	probably damaging	Het
Kifc2	A	G	15: 76,667,042	R679G	probably damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Ldha	A	T	7: 46,850,890	I171F	possibly damaging	Het
Lrfn4	T	C	19: 4,612,163	S609G	probably benign	Het
Mmp15	T	C	8: 95,368,101	F201S	possibly damaging	Het
Myof	C	T	19: 37,981,330	V295I	probably benign	Het
Olfr1024	G	T	2: 85,904,328	A242D	probably damaging	Het
Olfr30	T	A	11: 58,455,167	M261L	probably damaging	Het
Olfr354	C	T	2: 36,907,357	T137I	possibly damaging	Het
Parp14	T	C	16: 35,834,767	D1778G	probably benign	Het
Pcnt	A	T	10: 76,412,052	D969E	probably benign	Het
Pibf1	A	T	14: 99,112,992	N192I	probably benign	Het
Pitpnm3	A	G	11: 72,056,197	F792S	probably damaging	Het
Pkd2	T	A	5: 104,489,333	I604N	probably damaging	Het
Pla2g15	T	C	8: 106,161,143	Y188H	probably damaging	Het
Plxnc1	G	T	10: 94,864,774	D643E	probably benign	Het
Prrc2c	G	A	1: 162,673,511	P1241L	probably damaging	Het
Shank3	T	C	15: 89,532,354	V232A	probably damaging	Het
Shbg	A	G	11: 69,616,738	I171T	probably damaging	Het
Slc22a14	A	T	9: 119,173,608	F404L	probably benign	Het
Slc37a3	C	A	6: 39,355,026	G158C	probably damaging	Het
Slfn9	C	A	11: 82,982,381	L565F	probably damaging	Het
Tex43	G	A	18: 56,594,688		probably benign	Het
Trank1	T	A	9: 111,366,112	M1068K	probably damaging	Het
Trbv15	A	T	6: 41,141,253	I15L	probably benign	Het
Ttn	C	T	2: 76,739,574	V26992M	probably damaging	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ugt2b34	T	A	5: 86,906,701	I74F	probably damaging	Het
Vamp3	A	G	4: 151,051,020	L47P	probably damaging	Het
Zfp143	T	A	7: 110,083,315	C363*	probably null	Het
Zfp438	T	C	18: 5,213,761	E399G	probably damaging	Het

Other mutations in Ptprd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Ptprd	APN	4	75998556	nonsense	probably null
IGL01067:Ptprd	APN	4	76059685	missense	probably damaging	1.00
IGL01121:Ptprd	APN	4	75954201	splice site	probably benign
IGL01531:Ptprd	APN	4	76085520	missense	probably damaging	0.98
IGL01661:Ptprd	APN	4	75954083	missense	probably damaging	1.00
IGL01723:Ptprd	APN	4	76243673	missense	probably damaging	1.00
IGL01735:Ptprd	APN	4	76136820	unclassified	probably null
IGL01810:Ptprd	APN	4	76140507	splice site	probably benign
IGL01834:Ptprd	APN	4	76128595	missense	probably damaging	1.00
IGL01835:Ptprd	APN	4	76246821	missense	probably benign	0.02
IGL01867:Ptprd	APN	4	76243647	missense	probably damaging	1.00
IGL02582:Ptprd	APN	4	75947124	missense	probably damaging	1.00
IGL02591:Ptprd	APN	4	75982050	missense	probably damaging	1.00
IGL02741:Ptprd	APN	4	76133284	missense	probably damaging	1.00
IGL02866:Ptprd	APN	4	76050437	missense	probably damaging	1.00
IGL02960:Ptprd	APN	4	76128868	missense	probably damaging	1.00
IGL03155:Ptprd	APN	4	76066219	missense	possibly damaging	0.95
IGL03230:Ptprd	APN	4	76050417	nonsense	probably null
IGL03343:Ptprd	APN	4	76059729	missense	probably damaging	1.00
unhurried	UTSW	4	76100633	nonsense	probably null
ANU22:Ptprd	UTSW	4	76100456	missense	probably damaging	0.99
F5493:Ptprd	UTSW	4	76084408	missense	probably damaging	1.00
P0033:Ptprd	UTSW	4	76128854	nonsense	probably null
R0044:Ptprd	UTSW	4	76086329	missense	probably benign	0.08
R0044:Ptprd	UTSW	4	76086329	missense	probably benign	0.08
R0076:Ptprd	UTSW	4	75947039	splice site	probably benign
R0137:Ptprd	UTSW	4	76136903	missense	probably benign	0.24
R0358:Ptprd	UTSW	4	75944989	missense	probably damaging	1.00
R0365:Ptprd	UTSW	4	76136846	missense	probably damaging	1.00
R0385:Ptprd	UTSW	4	76128665	missense	probably damaging	1.00
R0601:Ptprd	UTSW	4	76100474	missense	probably benign
R0646:Ptprd	UTSW	4	76084403	missense	probably damaging	0.99
R0667:Ptprd	UTSW	4	75957346	missense	probably damaging	1.00
R0707:Ptprd	UTSW	4	75957239	missense	probably damaging	1.00
R0734:Ptprd	UTSW	4	76140597	missense	probably damaging	1.00
R0827:Ptprd	UTSW	4	76128915	missense	probably damaging	0.98
R0932:Ptprd	UTSW	4	76136885	missense	probably damaging	1.00
R1069:Ptprd	UTSW	4	75998487	splice site	probably benign
R1069:Ptprd	UTSW	4	76100633	nonsense	probably null
R1086:Ptprd	UTSW	4	76133258	missense	probably damaging	1.00
R1439:Ptprd	UTSW	4	76066200	missense	probably damaging	1.00
R1440:Ptprd	UTSW	4	76084552	missense	probably damaging	0.98
R1688:Ptprd	UTSW	4	75982684	missense	probably damaging	1.00
R1858:Ptprd	UTSW	4	75947147	missense	probably damaging	1.00
R2001:Ptprd	UTSW	4	75954122	missense	probably damaging	1.00
R2020:Ptprd	UTSW	4	76133161	missense	probably damaging	1.00
R2023:Ptprd	UTSW	4	75957104	missense	probably damaging	1.00
R2413:Ptprd	UTSW	4	76133200	missense	probably damaging	1.00
R2510:Ptprd	UTSW	4	76086011	critical splice donor site	probably null
R2914:Ptprd	UTSW	4	75947101	missense	probably damaging	1.00
R2971:Ptprd	UTSW	4	76107324	missense	probably benign	0.10
R3051:Ptprd	UTSW	4	76100630	missense	probably damaging	1.00
R3433:Ptprd	UTSW	4	76086011	critical splice donor site	probably null
R3964:Ptprd	UTSW	4	76059836	splice site	probably benign
R4009:Ptprd	UTSW	4	75956397	missense	possibly damaging	0.94
R4394:Ptprd	UTSW	4	76128685	missense	probably damaging	1.00
R4420:Ptprd	UTSW	4	76039377	missense	possibly damaging	0.92
R4424:Ptprd	UTSW	4	76102963	missense	probably benign	0.22
R4575:Ptprd	UTSW	4	76243786	missense	possibly damaging	0.55
R4578:Ptprd	UTSW	4	76243786	missense	possibly damaging	0.55
R4715:Ptprd	UTSW	4	76107333	missense	probably benign	0.03
R4782:Ptprd	UTSW	4	76091532	missense	probably benign	0.01
R4785:Ptprd	UTSW	4	76140553	missense	probably benign	0.05
R4799:Ptprd	UTSW	4	76091532	missense	probably benign	0.01
R4944:Ptprd	UTSW	4	76128899	missense	probably damaging	1.00
R4950:Ptprd	UTSW	4	76140515	splice site	probably null
R4969:Ptprd	UTSW	4	76133305	missense	probably damaging	1.00
R5153:Ptprd	UTSW	4	76012102	missense	probably damaging	1.00
R5164:Ptprd	UTSW	4	76100758	splice site	probably null
R5287:Ptprd	UTSW	4	75954168	nonsense	probably null
R5305:Ptprd	UTSW	4	75982626	missense	probably damaging	1.00
R5362:Ptprd	UTSW	4	76128813	missense	probably damaging	1.00
R5403:Ptprd	UTSW	4	75954168	nonsense	probably null
R5531:Ptprd	UTSW	4	76059667	critical splice donor site	probably null
R5634:Ptprd	UTSW	4	76072018	missense	probably benign	0.01
R5719:Ptprd	UTSW	4	76054602	critical splice acceptor site	probably null
R5884:Ptprd	UTSW	4	75982690	missense	probably damaging	1.00
R6247:Ptprd	UTSW	4	76066291	missense	probably benign	0.06
R6250:Ptprd	UTSW	4	76128995	missense	probably damaging	1.00
R6335:Ptprd	UTSW	4	75954183	missense	probably damaging	1.00
R6352:Ptprd	UTSW	4	76091552	unclassified	probably null
R6533:Ptprd	UTSW	4	76128528	missense	probably damaging	1.00
R6756:Ptprd	UTSW	4	75955299	missense	probably damaging	1.00
R6782:Ptprd	UTSW	4	76325140	intron	probably null
R7131:Ptprd	UTSW	4	76066340	missense	probably damaging	1.00
R7170:Ptprd	UTSW	4	76071962	missense	probably benign	0.06
R7233:Ptprd	UTSW	4	76059783	missense	probably benign	0.00
R7246:Ptprd	UTSW	4	76128676	missense	probably damaging	1.00
R7413:Ptprd	UTSW	4	76246839	missense	probably benign	0.00
R7428:Ptprd	UTSW	4	76086468	missense	probably benign	0.03
R7442:Ptprd	UTSW	4	76059821	nonsense	probably null
R7491:Ptprd	UTSW	4	76133155	missense	probably benign	0.23
R7526:Ptprd	UTSW	4	76066327	missense	probably benign	0.00
R7609:Ptprd	UTSW	4	76072003	missense	probably benign	0.03
R7612:Ptprd	UTSW	4	76086459	missense	probably benign	0.45
R7659:Ptprd	UTSW	4	76128916	missense	probably benign	0.03
R7743:Ptprd	UTSW	4	76086089	missense	probably damaging	1.00
R7748:Ptprd	UTSW	4	76099504	missense	probably null	0.39
R7788:Ptprd	UTSW	4	75998604	missense	probably damaging	1.00
R7836:Ptprd	UTSW	4	75982644	missense	probably damaging	0.99
R7919:Ptprd	UTSW	4	75982644	missense	probably damaging	0.99
RF016:Ptprd	UTSW	4	76128655	missense	probably benign	0.01
RF023:Ptprd	UTSW	4	76128565	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTTACTGGGCTGTCTTCAAATG -3'
(R):5'- CCAGTAAAATGACTTCATCAACCTG -3'

Sequencing Primer
(F):5'- GGGCTGTCTTCAAATGTATAAAGTC -3'
(R):5'- AAATGACTTCATCAACCTGTCATC -3'

Posted On

2016-10-24