Incidental Mutation 'R5543:Ptprd'
ID436084
Institutional Source Beutler Lab
Gene Symbol Ptprd
Ensembl Gene ENSMUSG00000028399
Gene Nameprotein tyrosine phosphatase, receptor type, D
Synonyms1110002J03Rik, 3000002J10Rik, B230219D21Rik
MMRRC Submission 043101-MU
Accession Numbers

Ncbi RefSeq: NM_001014288.2, NM_011211.2; MGI:97812

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5543 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location75941238-78211961 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76059753 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 173 (E173G)
Ref Sequence ENSEMBL: ENSMUSP00000148560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050757] [ENSMUST00000098005] [ENSMUST00000102834] [ENSMUST00000107289] [ENSMUST00000173376] [ENSMUST00000174023] [ENSMUST00000174180] [ENSMUST00000174531] [ENSMUST00000174831] [ENSMUST00000212365]
Predicted Effect probably damaging
Transcript: ENSMUST00000050757
AA Change: E843G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058466
Gene: ENSMUSG00000028399
AA Change: E843G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
IGc2 238 299 8.13e-4 SMART
FN3 313 392 7.92e-14 SMART
FN3 408 491 5.73e-11 SMART
IG_like 499 593 8.34e1 SMART
FN3 506 584 9.1e-14 SMART
FN3 597 674 1.21e0 SMART
transmembrane domain 847 869 N/A INTRINSIC
low complexity region 870 882 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000098005
AA Change: E853G

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095614
Gene: ENSMUSG00000028399
AA Change: E853G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 886 897 N/A INTRINSIC
PTPc 950 1208 6.38e-134 SMART
PTPc 1237 1499 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102834
AA Change: E606G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000099898
Gene: ENSMUSG00000028399
AA Change: E606G

DomainStartEndE-ValueType
IGc2 1 62 8.13e-4 SMART
FN3 76 155 7.92e-14 SMART
FN3 171 254 5.73e-11 SMART
IG_like 262 356 8.34e1 SMART
FN3 269 347 9.1e-14 SMART
FN3 360 437 1.21e0 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 633 645 N/A INTRINSIC
PTPc 698 956 6.38e-134 SMART
PTPc 985 1247 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107289
AA Change: E1264G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102910
Gene: ENSMUSG00000028399
AA Change: E1264G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 609 696 2.72e-12 SMART
FN3 712 809 2.87e-11 SMART
FN3 824 904 4.96e-6 SMART
FN3 919 1003 4.12e-12 SMART
FN3 1018 1095 1.95e0 SMART
transmembrane domain 1268 1290 N/A INTRINSIC
low complexity region 1291 1303 N/A INTRINSIC
PTPc 1356 1614 6.38e-134 SMART
PTPc 1643 1905 9.17e-135 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173376
AA Change: E860G

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133468
Gene: ENSMUSG00000028399
AA Change: E860G

DomainStartEndE-ValueType
IGc2 43 112 8.57e-12 SMART
IGc2 145 221 8.5e-16 SMART
low complexity region 232 244 N/A INTRINSIC
IGc2 255 316 8.13e-4 SMART
FN3 330 409 7.92e-14 SMART
FN3 425 508 5.73e-11 SMART
IG_like 516 610 8.34e1 SMART
FN3 523 601 9.1e-14 SMART
FN3 614 691 1.21e0 SMART
transmembrane domain 864 886 N/A INTRINSIC
low complexity region 887 899 N/A INTRINSIC
PTPc 952 1210 6.38e-134 SMART
PTPc 1239 1501 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174023
AA Change: E850G

PolyPhen 2 Score 0.146 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000133562
Gene: ENSMUSG00000028399
AA Change: E850G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 211 4.88e-16 SMART
low complexity region 222 234 N/A INTRINSIC
IGc2 245 306 8.13e-4 SMART
FN3 320 399 7.92e-14 SMART
FN3 415 498 5.73e-11 SMART
IG_like 506 600 8.34e1 SMART
FN3 513 591 9.1e-14 SMART
FN3 604 681 1.21e0 SMART
transmembrane domain 853 875 N/A INTRINSIC
low complexity region 882 893 N/A INTRINSIC
PTPc 946 1204 6.38e-134 SMART
PTPc 1233 1495 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174180
AA Change: E1242G

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000133973
Gene: ENSMUSG00000028399
AA Change: E1242G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 205 2.09e-15 SMART
IGc2 235 296 8.13e-4 SMART
FN3 310 389 7.92e-14 SMART
FN3 405 488 5.73e-11 SMART
IG_like 496 590 8.34e1 SMART
FN3 503 581 9.1e-14 SMART
FN3 596 683 2.72e-12 SMART
FN3 699 787 6.15e-11 SMART
FN3 802 882 4.96e-6 SMART
FN3 897 981 4.12e-12 SMART
FN3 996 1073 1.95e0 SMART
transmembrane domain 1246 1268 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
PTPc 1334 1592 6.38e-134 SMART
PTPc 1621 1883 9.17e-135 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174531
AA Change: E847G

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000134229
Gene: ENSMUSG00000028399
AA Change: E847G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 208 1.38e-15 SMART
low complexity region 219 231 N/A INTRINSIC
IGc2 242 303 8.13e-4 SMART
FN3 317 396 7.92e-14 SMART
FN3 412 495 5.73e-11 SMART
IG_like 503 597 8.34e1 SMART
FN3 510 588 9.1e-14 SMART
FN3 601 678 1.21e0 SMART
transmembrane domain 851 873 N/A INTRINSIC
low complexity region 874 886 N/A INTRINSIC
PTPc 939 1197 6.38e-134 SMART
PTPc 1226 1488 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174831
AA Change: E853G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133328
Gene: ENSMUSG00000028399
AA Change: E853G

DomainStartEndE-ValueType
IGc2 36 105 8.57e-12 SMART
IGc2 138 214 8.5e-16 SMART
low complexity region 225 237 N/A INTRINSIC
IGc2 248 309 8.13e-4 SMART
FN3 323 402 7.92e-14 SMART
FN3 418 501 5.73e-11 SMART
IG_like 509 603 8.34e1 SMART
FN3 516 594 9.1e-14 SMART
FN3 607 684 1.21e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 885 896 N/A INTRINSIC
PTPc 949 1207 6.38e-134 SMART
PTPc 1236 1498 9.17e-135 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212365
AA Change: E173G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype Strain: 2158795
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired learning of spatial tasks, enhanced long-term potentiation at hippocampal synapses, and high mortality associated with reduced food intake. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)
 

Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik C A 7: 128,237,181 S80I probably benign Het
Aak1 T C 6: 86,982,645 probably null Het
Abcc6 A G 7: 45,989,536 probably null Het
Acvr1 A G 2: 58,463,145 S268P probably damaging Het
Apod T C 16: 31,303,533 probably null Het
Atp5o T C 16: 91,926,530 I58V probably benign Het
AU040320 C T 4: 126,841,224 T777M probably damaging Het
BC067074 C A 13: 113,320,873 T1151K probably damaging Het
Ccne2 A T 4: 11,194,026 N89I probably benign Het
Dnah7a A G 1: 53,504,069 V2314A probably damaging Het
Dopey2 T C 16: 93,798,920 S1881P probably damaging Het
E4f1 A G 17: 24,447,362 V24A possibly damaging Het
Esrrg A T 1: 188,150,254 D236V probably damaging Het
Fam240b T A 13: 64,485,922 I27F possibly damaging Het
Fat1 T A 8: 45,023,479 I1854N probably damaging Het
Fchsd2 T C 7: 101,271,699 Y480H probably damaging Het
Fras1 A G 5: 96,528,535 N47S probably benign Het
Gabrr3 T C 16: 59,433,507 S196P probably damaging Het
Gbp8 T A 5: 105,017,830 D319V possibly damaging Het
Hrh3 G T 2: 180,103,970 A61E probably damaging Het
Idua T C 5: 108,670,229 I89T probably benign Het
Ifitm3 T A 7: 141,009,817 I108F unknown Het
Izumo4 T C 10: 80,702,834 F40S probably damaging Het
Kifc2 A G 15: 76,667,042 R679G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ldha A T 7: 46,850,890 I171F possibly damaging Het
Lrfn4 T C 19: 4,612,163 S609G probably benign Het
Mmp15 T C 8: 95,368,101 F201S possibly damaging Het
Myof C T 19: 37,981,330 V295I probably benign Het
Olfr1024 G T 2: 85,904,328 A242D probably damaging Het
Olfr30 T A 11: 58,455,167 M261L probably damaging Het
Olfr354 C T 2: 36,907,357 T137I possibly damaging Het
Parp14 T C 16: 35,834,767 D1778G probably benign Het
Pcnt A T 10: 76,412,052 D969E probably benign Het
Pibf1 A T 14: 99,112,992 N192I probably benign Het
Pitpnm3 A G 11: 72,056,197 F792S probably damaging Het
Pkd2 T A 5: 104,489,333 I604N probably damaging Het
Pla2g15 T C 8: 106,161,143 Y188H probably damaging Het
Plxnc1 G T 10: 94,864,774 D643E probably benign Het
Prrc2c G A 1: 162,673,511 P1241L probably damaging Het
Shank3 T C 15: 89,532,354 V232A probably damaging Het
Shbg A G 11: 69,616,738 I171T probably damaging Het
Slc22a14 A T 9: 119,173,608 F404L probably benign Het
Slc37a3 C A 6: 39,355,026 G158C probably damaging Het
Slfn9 C A 11: 82,982,381 L565F probably damaging Het
Tex43 G A 18: 56,594,688 probably benign Het
Trank1 T A 9: 111,366,112 M1068K probably damaging Het
Trbv15 A T 6: 41,141,253 I15L probably benign Het
Ttn C T 2: 76,739,574 V26992M probably damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ugt2b34 T A 5: 86,906,701 I74F probably damaging Het
Vamp3 A G 4: 151,051,020 L47P probably damaging Het
Zfp143 T A 7: 110,083,315 C363* probably null Het
Zfp438 T C 18: 5,213,761 E399G probably damaging Het
Other mutations in Ptprd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Ptprd APN 4 75998556 nonsense probably null
IGL01067:Ptprd APN 4 76059685 missense probably damaging 1.00
IGL01121:Ptprd APN 4 75954201 splice site probably benign
IGL01531:Ptprd APN 4 76085520 missense probably damaging 0.98
IGL01661:Ptprd APN 4 75954083 missense probably damaging 1.00
IGL01723:Ptprd APN 4 76243673 missense probably damaging 1.00
IGL01735:Ptprd APN 4 76136820 unclassified probably null
IGL01810:Ptprd APN 4 76140507 splice site probably benign
IGL01834:Ptprd APN 4 76128595 missense probably damaging 1.00
IGL01835:Ptprd APN 4 76246821 missense probably benign 0.02
IGL01867:Ptprd APN 4 76243647 missense probably damaging 1.00
IGL02582:Ptprd APN 4 75947124 missense probably damaging 1.00
IGL02591:Ptprd APN 4 75982050 missense probably damaging 1.00
IGL02741:Ptprd APN 4 76133284 missense probably damaging 1.00
IGL02866:Ptprd APN 4 76050437 missense probably damaging 1.00
IGL02960:Ptprd APN 4 76128868 missense probably damaging 1.00
IGL03155:Ptprd APN 4 76066219 missense possibly damaging 0.95
IGL03230:Ptprd APN 4 76050417 nonsense probably null
IGL03343:Ptprd APN 4 76059729 missense probably damaging 1.00
unhurried UTSW 4 76100633 nonsense probably null
ANU22:Ptprd UTSW 4 76100456 missense probably damaging 0.99
F5493:Ptprd UTSW 4 76084408 missense probably damaging 1.00
P0033:Ptprd UTSW 4 76128854 nonsense probably null
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0044:Ptprd UTSW 4 76086329 missense probably benign 0.08
R0076:Ptprd UTSW 4 75947039 splice site probably benign
R0137:Ptprd UTSW 4 76136903 missense probably benign 0.24
R0358:Ptprd UTSW 4 75944989 missense probably damaging 1.00
R0365:Ptprd UTSW 4 76136846 missense probably damaging 1.00
R0385:Ptprd UTSW 4 76128665 missense probably damaging 1.00
R0601:Ptprd UTSW 4 76100474 missense probably benign
R0646:Ptprd UTSW 4 76084403 missense probably damaging 0.99
R0667:Ptprd UTSW 4 75957346 missense probably damaging 1.00
R0707:Ptprd UTSW 4 75957239 missense probably damaging 1.00
R0734:Ptprd UTSW 4 76140597 missense probably damaging 1.00
R0827:Ptprd UTSW 4 76128915 missense probably damaging 0.98
R0932:Ptprd UTSW 4 76136885 missense probably damaging 1.00
R1069:Ptprd UTSW 4 75998487 splice site probably benign
R1069:Ptprd UTSW 4 76100633 nonsense probably null
R1086:Ptprd UTSW 4 76133258 missense probably damaging 1.00
R1439:Ptprd UTSW 4 76066200 missense probably damaging 1.00
R1440:Ptprd UTSW 4 76084552 missense probably damaging 0.98
R1688:Ptprd UTSW 4 75982684 missense probably damaging 1.00
R1858:Ptprd UTSW 4 75947147 missense probably damaging 1.00
R2001:Ptprd UTSW 4 75954122 missense probably damaging 1.00
R2020:Ptprd UTSW 4 76133161 missense probably damaging 1.00
R2023:Ptprd UTSW 4 75957104 missense probably damaging 1.00
R2413:Ptprd UTSW 4 76133200 missense probably damaging 1.00
R2510:Ptprd UTSW 4 76086011 critical splice donor site probably null
R2914:Ptprd UTSW 4 75947101 missense probably damaging 1.00
R2971:Ptprd UTSW 4 76107324 missense probably benign 0.10
R3051:Ptprd UTSW 4 76100630 missense probably damaging 1.00
R3433:Ptprd UTSW 4 76086011 critical splice donor site probably null
R3964:Ptprd UTSW 4 76059836 splice site probably benign
R4009:Ptprd UTSW 4 75956397 missense possibly damaging 0.94
R4394:Ptprd UTSW 4 76128685 missense probably damaging 1.00
R4420:Ptprd UTSW 4 76039377 missense possibly damaging 0.92
R4424:Ptprd UTSW 4 76102963 missense probably benign 0.22
R4575:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4578:Ptprd UTSW 4 76243786 missense possibly damaging 0.55
R4715:Ptprd UTSW 4 76107333 missense probably benign 0.03
R4782:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4785:Ptprd UTSW 4 76140553 missense probably benign 0.05
R4799:Ptprd UTSW 4 76091532 missense probably benign 0.01
R4944:Ptprd UTSW 4 76128899 missense probably damaging 1.00
R4950:Ptprd UTSW 4 76140515 splice site probably null
R4969:Ptprd UTSW 4 76133305 missense probably damaging 1.00
R5153:Ptprd UTSW 4 76012102 missense probably damaging 1.00
R5164:Ptprd UTSW 4 76100758 splice site probably null
R5287:Ptprd UTSW 4 75954168 nonsense probably null
R5305:Ptprd UTSW 4 75982626 missense probably damaging 1.00
R5362:Ptprd UTSW 4 76128813 missense probably damaging 1.00
R5403:Ptprd UTSW 4 75954168 nonsense probably null
R5531:Ptprd UTSW 4 76059667 critical splice donor site probably null
R5634:Ptprd UTSW 4 76072018 missense probably benign 0.01
R5719:Ptprd UTSW 4 76054602 critical splice acceptor site probably null
R5884:Ptprd UTSW 4 75982690 missense probably damaging 1.00
R6247:Ptprd UTSW 4 76066291 missense probably benign 0.06
R6250:Ptprd UTSW 4 76128995 missense probably damaging 1.00
R6335:Ptprd UTSW 4 75954183 missense probably damaging 1.00
R6352:Ptprd UTSW 4 76091552 unclassified probably null
R6533:Ptprd UTSW 4 76128528 missense probably damaging 1.00
R6756:Ptprd UTSW 4 75955299 missense probably damaging 1.00
R6782:Ptprd UTSW 4 76325140 intron probably null
R7131:Ptprd UTSW 4 76066340 missense probably damaging 1.00
R7170:Ptprd UTSW 4 76071962 missense probably benign 0.06
R7233:Ptprd UTSW 4 76059783 missense probably benign 0.00
R7246:Ptprd UTSW 4 76128676 missense probably damaging 1.00
R7413:Ptprd UTSW 4 76246839 missense probably benign 0.00
R7428:Ptprd UTSW 4 76086468 missense probably benign 0.03
R7442:Ptprd UTSW 4 76059821 nonsense probably null
R7491:Ptprd UTSW 4 76133155 missense probably benign 0.23
R7526:Ptprd UTSW 4 76066327 missense probably benign 0.00
R7609:Ptprd UTSW 4 76072003 missense probably benign 0.03
R7612:Ptprd UTSW 4 76086459 missense probably benign 0.45
R7659:Ptprd UTSW 4 76128916 missense probably benign 0.03
R7743:Ptprd UTSW 4 76086089 missense probably damaging 1.00
R7748:Ptprd UTSW 4 76099504 missense probably null 0.39
R7788:Ptprd UTSW 4 75998604 missense probably damaging 1.00
R7836:Ptprd UTSW 4 75982644 missense probably damaging 0.99
R7919:Ptprd UTSW 4 75982644 missense probably damaging 0.99
RF016:Ptprd UTSW 4 76128655 missense probably benign 0.01
RF023:Ptprd UTSW 4 76128565 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTTACTGGGCTGTCTTCAAATG -3'
(R):5'- CCAGTAAAATGACTTCATCAACCTG -3'

Sequencing Primer
(F):5'- GGGCTGTCTTCAAATGTATAAAGTC -3'
(R):5'- AAATGACTTCATCAACCTGTCATC -3'
Posted On2016-10-24